Incidental Mutation 'R5104:Ano4'
ID392568
Institutional Source Beutler Lab
Gene Symbol Ano4
Ensembl Gene ENSMUSG00000035189
Gene Nameanoctamin 4
SynonymsA330096O15Rik, Tmem16d
MMRRC Submission 042692-MU
Accession Numbers

Ncbi RefSeq: NM_178773.4; MGI: 2443344

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5104 (G1)
Quality Score204
Status Not validated
Chromosome10
Chromosomal Location88948994-89344762 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89068112 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 241 (Q241L)
Ref Sequence ENSEMBL: ENSMUSP00000138193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000181976] [ENSMUST00000182341] [ENSMUST00000182419] [ENSMUST00000182462] [ENSMUST00000182613] [ENSMUST00000182790] [ENSMUST00000183268]
Predicted Effect possibly damaging
Transcript: ENSMUST00000181976
AA Change: Q241L

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182041
Predicted Effect possibly damaging
Transcript: ENSMUST00000182341
AA Change: Q241L

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138193
Gene: ENSMUSG00000035189
AA Change: Q241L

DomainStartEndE-ValueType
Pfam:Anoctamin 339 922 4.8e-162 PFAM
low complexity region 932 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182419
SMART Domains Protein: ENSMUSP00000138435
Gene: ENSMUSG00000035189

DomainStartEndE-ValueType
low complexity region 97 110 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182462
Predicted Effect probably benign
Transcript: ENSMUST00000182613
AA Change: Q206L

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138268
Gene: ENSMUSG00000035189
AA Change: Q206L

DomainStartEndE-ValueType
Pfam:Anoctamin 304 887 3.6e-162 PFAM
low complexity region 897 910 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182790
AA Change: Q206L

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138325
Gene: ENSMUSG00000035189
AA Change: Q206L

DomainStartEndE-ValueType
Pfam:Anoctamin 304 887 3.6e-162 PFAM
low complexity region 897 910 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183268
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.0%
Validation Efficiency
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,731,240 V883A probably benign Het
3632451O06Rik A T 14: 49,773,472 D259E possibly damaging Het
Adarb1 A G 10: 77,322,287 F109L probably damaging Het
Apof C T 10: 128,269,618 R214* probably null Het
Atl2 A T 17: 79,852,617 S47T probably benign Het
Azgp1 T G 5: 137,987,553 I146S probably damaging Het
Bicral G A 17: 46,801,256 T1006I probably damaging Het
Ccdc110 A T 8: 45,942,692 N540I probably damaging Het
Ccdc77 T C 6: 120,348,385 probably null Het
Cxcr5 G T 9: 44,513,319 P347Q probably benign Het
Cyp4a14 T G 4: 115,495,929 H62P probably damaging Het
Dgki T C 6: 37,149,574 E157G possibly damaging Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Ehd3 A G 17: 73,827,447 N267S probably benign Het
Eno4 A G 19: 58,945,541 Y58C probably benign Het
Fat2 A G 11: 55,278,988 Y2982H possibly damaging Het
Frmd3 C A 4: 74,145,078 A214D probably damaging Het
Gabrg1 A C 5: 70,774,432 S323A probably damaging Het
Gbp9 T C 5: 105,080,141 I592V probably benign Het
Gje1 G A 10: 14,716,718 Q107* probably null Het
Gm29609 T C 5: 31,154,294 probably null Het
Gpam A T 19: 55,093,986 F78I probably benign Het
Hecw1 T C 13: 14,340,792 R252G probably damaging Het
Hsd3b5 T A 3: 98,619,276 S285C probably damaging Het
Ighv1-74 T C 12: 115,802,887 K37E possibly damaging Het
Igkv8-34 T C 6: 70,044,154 D108G probably damaging Het
Il6st C G 13: 112,488,648 T266S probably benign Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kit A G 5: 75,615,478 T307A probably benign Het
Kmt2b G A 7: 30,569,840 R2552C probably damaging Het
Krt4 T A 15: 101,920,323 R369W probably damaging Het
Larp4 T A 15: 99,986,083 M8K probably damaging Het
Lrit3 T A 3: 129,788,391 H528L possibly damaging Het
Mia3 A G 1: 183,338,132 L157S probably damaging Het
Naa16 A T 14: 79,384,700 Y32* probably null Het
Nbea A G 3: 56,079,927 Y381H probably damaging Het
Nelfcd T C 2: 174,426,366 V475A probably benign Het
Noxa1 T C 2: 25,086,234 I347M probably benign Het
Olfr131 A T 17: 38,082,283 S232T possibly damaging Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr699 A T 7: 106,790,332 F223Y possibly damaging Het
Olfr747 T A 14: 50,680,702 K311* probably null Het
Pabpc1l T A 2: 164,043,587 I420K probably benign Het
Pi4ka C T 16: 17,281,050 C1990Y probably damaging Het
Pkhd1 T A 1: 20,585,191 Q223L probably damaging Het
Pkm G T 9: 59,668,681 probably null Het
Proz A G 8: 13,066,931 D161G probably damaging Het
Ptprb C A 10: 116,322,459 H765Q probably benign Het
Rffl A T 11: 82,812,793 C101* probably null Het
Rfx5 C T 3: 94,955,140 T36I probably benign Het
Rnase12 C A 14: 51,056,904 C106F probably damaging Het
Samd3 T C 10: 26,263,788 S273P possibly damaging Het
Simc1 A G 13: 54,526,362 D841G probably benign Het
Slc8a3 T C 12: 81,214,134 E607G probably null Het
Snrnp40 G T 4: 130,365,165 G122V possibly damaging Het
Snx25 T C 8: 46,068,166 *143W probably null Het
Taf15 A G 11: 83,487,396 Y154C probably damaging Het
Tgfb3 A G 12: 86,058,982 V333A possibly damaging Het
Tiam1 A G 16: 89,818,041 S2P probably benign Het
Tmed11 T C 5: 108,777,276 probably null Het
Tmtc4 T C 14: 122,932,845 D585G probably damaging Het
Trabd2b T C 4: 114,406,917 S34P probably benign Het
Trbv13-2 T C 6: 41,121,811 Y107H probably damaging Het
Tuba3a A G 6: 125,282,384 V115A probably benign Het
Tut1 A G 19: 8,959,334 E174G probably benign Het
Ubr3 T A 2: 69,938,256 M469K probably damaging Het
Vcan C T 13: 89,657,472 probably benign Het
Wapl C T 14: 34,692,059 Q293* probably null Het
Wdr24 A G 17: 25,824,591 H129R probably damaging Het
Wrn A T 8: 33,267,867 probably null Het
Other mutations in Ano4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Ano4 APN 10 88954667 missense probably damaging 1.00
IGL00916:Ano4 APN 10 88998098 missense probably benign 0.01
IGL01010:Ano4 APN 10 88960600 missense probably benign 0.14
IGL01015:Ano4 APN 10 89035099 missense probably damaging 1.00
IGL01877:Ano4 APN 10 89025070 nonsense probably null 0.00
IGL02310:Ano4 APN 10 89023878 nonsense probably null
IGL02390:Ano4 APN 10 89024981 missense possibly damaging 0.88
IGL02560:Ano4 APN 10 88978741 nonsense probably null
Dwindle UTSW 10 88983778 missense probably damaging 0.98
P0017:Ano4 UTSW 10 88981190 nonsense probably null
PIT4486001:Ano4 UTSW 10 88993029 missense probably damaging 1.00
R0126:Ano4 UTSW 10 88952292 missense possibly damaging 0.73
R0380:Ano4 UTSW 10 88978813 missense possibly damaging 0.82
R0508:Ano4 UTSW 10 88980977 missense probably damaging 1.00
R0540:Ano4 UTSW 10 89023944 missense probably benign 0.00
R1802:Ano4 UTSW 10 88981016 missense probably damaging 1.00
R1864:Ano4 UTSW 10 88971391 missense probably damaging 1.00
R1871:Ano4 UTSW 10 88993027 missense probably damaging 1.00
R2829:Ano4 UTSW 10 89112939 missense possibly damaging 0.58
R2880:Ano4 UTSW 10 89112799 missense probably damaging 1.00
R3846:Ano4 UTSW 10 88995252 missense possibly damaging 0.93
R3904:Ano4 UTSW 10 89025005 missense probably damaging 1.00
R4006:Ano4 UTSW 10 89088263 missense probably benign 0.18
R4429:Ano4 UTSW 10 88992942 missense probably damaging 0.99
R4547:Ano4 UTSW 10 88981170 missense probably null
R4638:Ano4 UTSW 10 88954697 missense probably damaging 1.00
R4640:Ano4 UTSW 10 88954697 missense probably damaging 1.00
R4876:Ano4 UTSW 10 89112835 missense probably damaging 1.00
R5007:Ano4 UTSW 10 89112945 missense probably benign 0.26
R5151:Ano4 UTSW 10 89112913 missense probably damaging 1.00
R5215:Ano4 UTSW 10 89317303 missense possibly damaging 0.86
R5396:Ano4 UTSW 10 89112840 missense probably damaging 1.00
R5826:Ano4 UTSW 10 88952327 missense probably damaging 1.00
R6018:Ano4 UTSW 10 89029266 missense probably benign 0.01
R6036:Ano4 UTSW 10 88982265 missense possibly damaging 0.95
R6036:Ano4 UTSW 10 88982265 missense possibly damaging 0.95
R6037:Ano4 UTSW 10 89317246 missense possibly damaging 0.93
R6037:Ano4 UTSW 10 89317246 missense possibly damaging 0.93
R6222:Ano4 UTSW 10 89027222 missense probably damaging 1.00
R6387:Ano4 UTSW 10 88971405 nonsense probably null
R6521:Ano4 UTSW 10 88983778 missense probably damaging 0.98
R6739:Ano4 UTSW 10 89027252 missense probably damaging 1.00
R6786:Ano4 UTSW 10 88992870 splice site probably null
R7035:Ano4 UTSW 10 88954711 missense probably damaging 1.00
R7523:Ano4 UTSW 10 88971395 nonsense probably null
R7715:Ano4 UTSW 10 88995311 missense probably damaging 0.99
R8005:Ano4 UTSW 10 88971321 missense probably benign 0.04
R8024:Ano4 UTSW 10 88971332 missense probably damaging 1.00
T0970:Ano4 UTSW 10 88981190 nonsense probably null
Z1176:Ano4 UTSW 10 89112945 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- CAGCATGGAAGGTGTGATCC -3'
(R):5'- CAGAGTGATGTTGACTTGATGTATCC -3'

Sequencing Primer
(F):5'- TCTGAGCACTGTGAACTGAC -3'
(R):5'- GACTTGATGTATCCTTTGATCTTGC -3'
Posted On2016-06-15