Incidental Mutation 'R5104:Olfr747'
ID392586
Institutional Source Beutler Lab
Gene Symbol Olfr747
Ensembl Gene ENSMUSG00000057179
Gene Nameolfactory receptor 747
SynonymsGA_x6K02T2PMLR-6420220-6419279, MOR106-7, MOR106-16
MMRRC Submission 042692-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R5104 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location50680657-50693206 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 50680702 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 311 (K311*)
Ref Sequence ENSEMBL: ENSMUSP00000149081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078075] [ENSMUST00000205373] [ENSMUST00000205897] [ENSMUST00000213238]
Predicted Effect probably null
Transcript: ENSMUST00000078075
AA Change: K311*
SMART Domains Protein: ENSMUSP00000077220
Gene: ENSMUSG00000057179
AA Change: K311*

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 2.2e-53 PFAM
Pfam:7tm_1 40 289 2.8e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000205373
AA Change: K311*
Predicted Effect probably benign
Transcript: ENSMUST00000205897
Predicted Effect probably null
Transcript: ENSMUST00000213238
AA Change: K311*
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,731,240 V883A probably benign Het
3632451O06Rik A T 14: 49,773,472 D259E possibly damaging Het
Adarb1 A G 10: 77,322,287 F109L probably damaging Het
Ano4 T A 10: 89,068,112 Q241L possibly damaging Het
Apof C T 10: 128,269,618 R214* probably null Het
Atl2 A T 17: 79,852,617 S47T probably benign Het
Azgp1 T G 5: 137,987,553 I146S probably damaging Het
Bicral G A 17: 46,801,256 T1006I probably damaging Het
Ccdc110 A T 8: 45,942,692 N540I probably damaging Het
Ccdc77 T C 6: 120,348,385 probably null Het
Cxcr5 G T 9: 44,513,319 P347Q probably benign Het
Cyp4a14 T G 4: 115,495,929 H62P probably damaging Het
Dgki T C 6: 37,149,574 E157G possibly damaging Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Ehd3 A G 17: 73,827,447 N267S probably benign Het
Eno4 A G 19: 58,945,541 Y58C probably benign Het
Fat2 A G 11: 55,278,988 Y2982H possibly damaging Het
Frmd3 C A 4: 74,145,078 A214D probably damaging Het
Gabrg1 A C 5: 70,774,432 S323A probably damaging Het
Gbp9 T C 5: 105,080,141 I592V probably benign Het
Gje1 G A 10: 14,716,718 Q107* probably null Het
Gm29609 T C 5: 31,154,294 probably null Het
Gpam A T 19: 55,093,986 F78I probably benign Het
Hecw1 T C 13: 14,340,792 R252G probably damaging Het
Hsd3b5 T A 3: 98,619,276 S285C probably damaging Het
Ighv1-74 T C 12: 115,802,887 K37E possibly damaging Het
Igkv8-34 T C 6: 70,044,154 D108G probably damaging Het
Il6st C G 13: 112,488,648 T266S probably benign Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kit A G 5: 75,615,478 T307A probably benign Het
Kmt2b G A 7: 30,569,840 R2552C probably damaging Het
Krt4 T A 15: 101,920,323 R369W probably damaging Het
Larp4 T A 15: 99,986,083 M8K probably damaging Het
Lrit3 T A 3: 129,788,391 H528L possibly damaging Het
Mia3 A G 1: 183,338,132 L157S probably damaging Het
Naa16 A T 14: 79,384,700 Y32* probably null Het
Nbea A G 3: 56,079,927 Y381H probably damaging Het
Nelfcd T C 2: 174,426,366 V475A probably benign Het
Noxa1 T C 2: 25,086,234 I347M probably benign Het
Olfr131 A T 17: 38,082,283 S232T possibly damaging Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr699 A T 7: 106,790,332 F223Y possibly damaging Het
Pabpc1l T A 2: 164,043,587 I420K probably benign Het
Pi4ka C T 16: 17,281,050 C1990Y probably damaging Het
Pkhd1 T A 1: 20,585,191 Q223L probably damaging Het
Pkm G T 9: 59,668,681 probably null Het
Proz A G 8: 13,066,931 D161G probably damaging Het
Ptprb C A 10: 116,322,459 H765Q probably benign Het
Rffl A T 11: 82,812,793 C101* probably null Het
Rfx5 C T 3: 94,955,140 T36I probably benign Het
Rnase12 C A 14: 51,056,904 C106F probably damaging Het
Samd3 T C 10: 26,263,788 S273P possibly damaging Het
Simc1 A G 13: 54,526,362 D841G probably benign Het
Slc8a3 T C 12: 81,214,134 E607G probably null Het
Snrnp40 G T 4: 130,365,165 G122V possibly damaging Het
Snx25 T C 8: 46,068,166 *143W probably null Het
Taf15 A G 11: 83,487,396 Y154C probably damaging Het
Tgfb3 A G 12: 86,058,982 V333A possibly damaging Het
Tiam1 A G 16: 89,818,041 S2P probably benign Het
Tmed11 T C 5: 108,777,276 probably null Het
Tmtc4 T C 14: 122,932,845 D585G probably damaging Het
Trabd2b T C 4: 114,406,917 S34P probably benign Het
Trbv13-2 T C 6: 41,121,811 Y107H probably damaging Het
Tuba3a A G 6: 125,282,384 V115A probably benign Het
Tut1 A G 19: 8,959,334 E174G probably benign Het
Ubr3 T A 2: 69,938,256 M469K probably damaging Het
Vcan C T 13: 89,657,472 probably benign Het
Wapl C T 14: 34,692,059 Q293* probably null Het
Wdr24 A G 17: 25,824,591 H129R probably damaging Het
Wrn A T 8: 33,267,867 probably null Het
Other mutations in Olfr747
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02437:Olfr747 APN 14 50681200 missense probably benign 0.04
R0349:Olfr747 UTSW 14 50681254 missense probably benign 0.00
R0613:Olfr747 UTSW 14 50681404 missense probably benign 0.06
R1023:Olfr747 UTSW 14 50681016 missense probably damaging 1.00
R1126:Olfr747 UTSW 14 50681263 missense possibly damaging 0.94
R1298:Olfr747 UTSW 14 50680880 nonsense probably null
R1344:Olfr747 UTSW 14 50680858 missense probably benign
R1775:Olfr747 UTSW 14 50681166 missense possibly damaging 0.66
R1928:Olfr747 UTSW 14 50681415 missense probably benign 0.00
R2208:Olfr747 UTSW 14 50681563 missense probably benign 0.01
R4181:Olfr747 UTSW 14 50681050 missense probably benign 0.07
R4183:Olfr747 UTSW 14 50681050 missense probably benign 0.07
R4184:Olfr747 UTSW 14 50681050 missense probably benign 0.07
R6144:Olfr747 UTSW 14 50680935 missense probably benign 0.01
R6768:Olfr747 UTSW 14 50681592 missense probably damaging 1.00
R7026:Olfr747 UTSW 14 50681259 missense probably damaging 0.98
R7454:Olfr747 UTSW 14 50680824 missense possibly damaging 0.94
R7777:Olfr747 UTSW 14 50680804 missense probably damaging 1.00
R7851:Olfr747 UTSW 14 50681458 missense probably damaging 1.00
R7934:Olfr747 UTSW 14 50681458 missense probably damaging 1.00
X0067:Olfr747 UTSW 14 50681529 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- GAGTAGACCATCTCACATAGGAATC -3'
(R):5'- TGGTGTCACTCTTCTATGGGAC -3'

Sequencing Primer
(F):5'- GGGAATCAAGTCTCTACAAGGTCATC -3'
(R):5'- CATGAGTCCTACATATGGC -3'
Posted On2016-06-15