Incidental Mutation 'R5104:Tmtc4'
ID392589
Institutional Source Beutler Lab
Gene Symbol Tmtc4
Ensembl Gene ENSMUSG00000041594
Gene Nametransmembrane and tetratricopeptide repeat containing 4
Synonyms
MMRRC Submission 042692-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5104 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location122918971-122984035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122932845 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 585 (D585G)
Ref Sequence ENSEMBL: ENSMUSP00000121523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037726] [ENSMUST00000126867] [ENSMUST00000143189] [ENSMUST00000148661]
Predicted Effect probably damaging
Transcript: ENSMUST00000037726
AA Change: D585G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046368
Gene: ENSMUSG00000041594
AA Change: D585G

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 174 191 N/A INTRINSIC
transmembrane domain 201 220 N/A INTRINSIC
transmembrane domain 227 249 N/A INTRINSIC
transmembrane domain 269 288 N/A INTRINSIC
Pfam:DUF1736 290 369 3e-35 PFAM
transmembrane domain 386 408 N/A INTRINSIC
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
TPR 482 515 2.49e-5 SMART
TPR 516 549 9.03e-3 SMART
TPR 550 583 2.49e-5 SMART
TPR 584 617 2.63e-4 SMART
TPR 618 651 5.78e-1 SMART
TPR 652 685 2.19e-1 SMART
TPR 686 719 1.37e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126494
Predicted Effect probably damaging
Transcript: ENSMUST00000126867
AA Change: D585G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116379
Gene: ENSMUSG00000041594
AA Change: D585G

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 174 191 N/A INTRINSIC
transmembrane domain 201 220 N/A INTRINSIC
transmembrane domain 227 249 N/A INTRINSIC
transmembrane domain 269 288 N/A INTRINSIC
Pfam:DUF1736 290 369 3e-35 PFAM
transmembrane domain 386 408 N/A INTRINSIC
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
TPR 482 515 2.49e-5 SMART
TPR 516 549 9.03e-3 SMART
TPR 550 583 2.49e-5 SMART
TPR 584 617 2.63e-4 SMART
TPR 618 651 5.78e-1 SMART
TPR 652 685 2.19e-1 SMART
TPR 686 719 1.37e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135917
Predicted Effect probably benign
Transcript: ENSMUST00000143189
SMART Domains Protein: ENSMUSP00000116480
Gene: ENSMUSG00000041594

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
transmembrane domain 100 122 N/A INTRINSIC
transmembrane domain 165 187 N/A INTRINSIC
transmembrane domain 200 219 N/A INTRINSIC
transmembrane domain 224 246 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000148661
AA Change: D585G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121523
Gene: ENSMUSG00000041594
AA Change: D585G

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 174 191 N/A INTRINSIC
transmembrane domain 201 220 N/A INTRINSIC
transmembrane domain 227 249 N/A INTRINSIC
transmembrane domain 269 288 N/A INTRINSIC
Pfam:DUF1736 292 366 4.4e-36 PFAM
transmembrane domain 386 408 N/A INTRINSIC
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
TPR 482 515 2.49e-5 SMART
TPR 516 549 9.03e-3 SMART
TPR 550 583 2.49e-5 SMART
TPR 584 617 2.63e-4 SMART
TPR 618 651 5.78e-1 SMART
TPR 652 685 2.19e-1 SMART
TPR 686 719 1.37e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161599
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162218
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,731,240 V883A probably benign Het
3632451O06Rik A T 14: 49,773,472 D259E possibly damaging Het
Adarb1 A G 10: 77,322,287 F109L probably damaging Het
Ano4 T A 10: 89,068,112 Q241L possibly damaging Het
Apof C T 10: 128,269,618 R214* probably null Het
Atl2 A T 17: 79,852,617 S47T probably benign Het
Azgp1 T G 5: 137,987,553 I146S probably damaging Het
Bicral G A 17: 46,801,256 T1006I probably damaging Het
Ccdc110 A T 8: 45,942,692 N540I probably damaging Het
Ccdc77 T C 6: 120,348,385 probably null Het
Cxcr5 G T 9: 44,513,319 P347Q probably benign Het
Cyp4a14 T G 4: 115,495,929 H62P probably damaging Het
Dgki T C 6: 37,149,574 E157G possibly damaging Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Ehd3 A G 17: 73,827,447 N267S probably benign Het
Eno4 A G 19: 58,945,541 Y58C probably benign Het
Fat2 A G 11: 55,278,988 Y2982H possibly damaging Het
Frmd3 C A 4: 74,145,078 A214D probably damaging Het
Gabrg1 A C 5: 70,774,432 S323A probably damaging Het
Gbp9 T C 5: 105,080,141 I592V probably benign Het
Gje1 G A 10: 14,716,718 Q107* probably null Het
Gm29609 T C 5: 31,154,294 probably null Het
Gpam A T 19: 55,093,986 F78I probably benign Het
Hecw1 T C 13: 14,340,792 R252G probably damaging Het
Hsd3b5 T A 3: 98,619,276 S285C probably damaging Het
Ighv1-74 T C 12: 115,802,887 K37E possibly damaging Het
Igkv8-34 T C 6: 70,044,154 D108G probably damaging Het
Il6st C G 13: 112,488,648 T266S probably benign Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kit A G 5: 75,615,478 T307A probably benign Het
Kmt2b G A 7: 30,569,840 R2552C probably damaging Het
Krt4 T A 15: 101,920,323 R369W probably damaging Het
Larp4 T A 15: 99,986,083 M8K probably damaging Het
Lrit3 T A 3: 129,788,391 H528L possibly damaging Het
Mia3 A G 1: 183,338,132 L157S probably damaging Het
Naa16 A T 14: 79,384,700 Y32* probably null Het
Nbea A G 3: 56,079,927 Y381H probably damaging Het
Nelfcd T C 2: 174,426,366 V475A probably benign Het
Noxa1 T C 2: 25,086,234 I347M probably benign Het
Olfr131 A T 17: 38,082,283 S232T possibly damaging Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr699 A T 7: 106,790,332 F223Y possibly damaging Het
Olfr747 T A 14: 50,680,702 K311* probably null Het
Pabpc1l T A 2: 164,043,587 I420K probably benign Het
Pi4ka C T 16: 17,281,050 C1990Y probably damaging Het
Pkhd1 T A 1: 20,585,191 Q223L probably damaging Het
Pkm G T 9: 59,668,681 probably null Het
Proz A G 8: 13,066,931 D161G probably damaging Het
Ptprb C A 10: 116,322,459 H765Q probably benign Het
Rffl A T 11: 82,812,793 C101* probably null Het
Rfx5 C T 3: 94,955,140 T36I probably benign Het
Rnase12 C A 14: 51,056,904 C106F probably damaging Het
Samd3 T C 10: 26,263,788 S273P possibly damaging Het
Simc1 A G 13: 54,526,362 D841G probably benign Het
Slc8a3 T C 12: 81,214,134 E607G probably null Het
Snrnp40 G T 4: 130,365,165 G122V possibly damaging Het
Snx25 T C 8: 46,068,166 *143W probably null Het
Taf15 A G 11: 83,487,396 Y154C probably damaging Het
Tgfb3 A G 12: 86,058,982 V333A possibly damaging Het
Tiam1 A G 16: 89,818,041 S2P probably benign Het
Tmed11 T C 5: 108,777,276 probably null Het
Trabd2b T C 4: 114,406,917 S34P probably benign Het
Trbv13-2 T C 6: 41,121,811 Y107H probably damaging Het
Tuba3a A G 6: 125,282,384 V115A probably benign Het
Tut1 A G 19: 8,959,334 E174G probably benign Het
Ubr3 T A 2: 69,938,256 M469K probably damaging Het
Vcan C T 13: 89,657,472 probably benign Het
Wapl C T 14: 34,692,059 Q293* probably null Het
Wdr24 A G 17: 25,824,591 H129R probably damaging Het
Wrn A T 8: 33,267,867 probably null Het
Other mutations in Tmtc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Tmtc4 APN 14 122925954 splice site probably benign
IGL01408:Tmtc4 APN 14 122925954 splice site probably benign
IGL01487:Tmtc4 APN 14 122926031 missense probably benign 0.25
IGL01694:Tmtc4 APN 14 122973212 missense possibly damaging 0.92
IGL01934:Tmtc4 APN 14 122927635 nonsense probably null
IGL02456:Tmtc4 APN 14 122925962 critical splice donor site probably null
IGL03116:Tmtc4 APN 14 122927632 missense probably benign 0.02
IGL03326:Tmtc4 APN 14 122945540 missense probably damaging 0.99
PIT4403001:Tmtc4 UTSW 14 122973229 missense probably benign 0.01
R0344:Tmtc4 UTSW 14 122978160 missense probably damaging 1.00
R0630:Tmtc4 UTSW 14 122926090 splice site probably benign
R0849:Tmtc4 UTSW 14 122945554 missense possibly damaging 0.62
R1129:Tmtc4 UTSW 14 122943153 critical splice donor site probably null
R1601:Tmtc4 UTSW 14 122944826 missense probably benign 0.01
R1835:Tmtc4 UTSW 14 122941988 critical splice acceptor site probably null
R1966:Tmtc4 UTSW 14 122927599 missense probably benign 0.31
R2024:Tmtc4 UTSW 14 122921265 missense probably benign 0.02
R2025:Tmtc4 UTSW 14 122921265 missense probably benign 0.02
R2026:Tmtc4 UTSW 14 122921265 missense probably benign 0.02
R2027:Tmtc4 UTSW 14 122921265 missense probably benign 0.02
R2256:Tmtc4 UTSW 14 122941408 missense probably benign 0.09
R2439:Tmtc4 UTSW 14 122971903 missense probably damaging 1.00
R3001:Tmtc4 UTSW 14 122932818 critical splice donor site probably null
R3002:Tmtc4 UTSW 14 122932818 critical splice donor site probably null
R3894:Tmtc4 UTSW 14 122921319 intron probably null
R4561:Tmtc4 UTSW 14 122963298 missense probably benign 0.21
R4926:Tmtc4 UTSW 14 122973206 missense probably damaging 1.00
R5000:Tmtc4 UTSW 14 122933331 missense possibly damaging 0.46
R5024:Tmtc4 UTSW 14 122941302 splice site probably null
R5200:Tmtc4 UTSW 14 122945557 missense probably benign 0.05
R5536:Tmtc4 UTSW 14 122932879 missense probably benign 0.09
R5677:Tmtc4 UTSW 14 122950499 missense probably damaging 1.00
R5768:Tmtc4 UTSW 14 122933153 missense possibly damaging 0.91
R6467:Tmtc4 UTSW 14 122925979 missense possibly damaging 0.80
R7317:Tmtc4 UTSW 14 122978181 missense probably benign 0.00
R7516:Tmtc4 UTSW 14 122943323 missense possibly damaging 0.68
R7539:Tmtc4 UTSW 14 122978289 splice site probably null
R7584:Tmtc4 UTSW 14 122978151 missense probably benign 0.01
R7821:Tmtc4 UTSW 14 122971877 missense probably benign
R7903:Tmtc4 UTSW 14 122927648 missense probably benign 0.00
R7986:Tmtc4 UTSW 14 122927648 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTCATTCAGTTTGTATGGCTC -3'
(R):5'- CATTCTGCCAGGAACAAAGAGTG -3'

Sequencing Primer
(F):5'- GGCTCATTAATTAGAACTTCGGCAG -3'
(R):5'- GAACAGCCTGAAACGGTT -3'
Posted On2016-06-15