Incidental Mutation 'R5104:Tut1'
ID392602
Institutional Source Beutler Lab
Gene Symbol Tut1
Ensembl Gene ENSMUSG00000071645
Gene Nameterminal uridylyl transferase 1, U6 snRNA-specific
SynonymsPAPD2, Rbm21, 2700038E08Rik, TUTase6
MMRRC Submission 042692-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.571) question?
Stock #R5104 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location8953850-8966207 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8959334 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 174 (E174G)
Ref Sequence ENSEMBL: ENSMUSP00000093958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096239]
Predicted Effect probably benign
Transcript: ENSMUST00000096239
AA Change: E174G

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000093958
Gene: ENSMUSG00000071645
AA Change: E174G

DomainStartEndE-ValueType
ZnF_C2H2 16 40 1.53e-1 SMART
RRM 57 124 2.02e-10 SMART
SCOP:d1f5aa2 173 221 1e-3 SMART
low complexity region 242 258 N/A INTRINSIC
low complexity region 300 314 N/A INTRINSIC
low complexity region 324 347 N/A INTRINSIC
low complexity region 423 434 N/A INTRINSIC
Pfam:PAP_assoc 493 552 2.7e-8 PFAM
low complexity region 594 618 N/A INTRINSIC
low complexity region 767 782 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleotidyl transferase that functions as both a terminal uridylyltransferase and a nuclear poly(A) polymerase. The encoded enzyme specifically adds and removes nucleotides from the 3' end of small nuclear RNAs and select mRNAs and may function in controlling gene expression and cell proliferation.[provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,731,240 V883A probably benign Het
3632451O06Rik A T 14: 49,773,472 D259E possibly damaging Het
Adarb1 A G 10: 77,322,287 F109L probably damaging Het
Ano4 T A 10: 89,068,112 Q241L possibly damaging Het
Apof C T 10: 128,269,618 R214* probably null Het
Atl2 A T 17: 79,852,617 S47T probably benign Het
Azgp1 T G 5: 137,987,553 I146S probably damaging Het
Bicral G A 17: 46,801,256 T1006I probably damaging Het
Ccdc110 A T 8: 45,942,692 N540I probably damaging Het
Ccdc77 T C 6: 120,348,385 probably null Het
Cxcr5 G T 9: 44,513,319 P347Q probably benign Het
Cyp4a14 T G 4: 115,495,929 H62P probably damaging Het
Dgki T C 6: 37,149,574 E157G possibly damaging Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Ehd3 A G 17: 73,827,447 N267S probably benign Het
Eno4 A G 19: 58,945,541 Y58C probably benign Het
Fat2 A G 11: 55,278,988 Y2982H possibly damaging Het
Frmd3 C A 4: 74,145,078 A214D probably damaging Het
Gabrg1 A C 5: 70,774,432 S323A probably damaging Het
Gbp9 T C 5: 105,080,141 I592V probably benign Het
Gje1 G A 10: 14,716,718 Q107* probably null Het
Gm29609 T C 5: 31,154,294 probably null Het
Gpam A T 19: 55,093,986 F78I probably benign Het
Hecw1 T C 13: 14,340,792 R252G probably damaging Het
Hsd3b5 T A 3: 98,619,276 S285C probably damaging Het
Ighv1-74 T C 12: 115,802,887 K37E possibly damaging Het
Igkv8-34 T C 6: 70,044,154 D108G probably damaging Het
Il6st C G 13: 112,488,648 T266S probably benign Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kit A G 5: 75,615,478 T307A probably benign Het
Kmt2b G A 7: 30,569,840 R2552C probably damaging Het
Krt4 T A 15: 101,920,323 R369W probably damaging Het
Larp4 T A 15: 99,986,083 M8K probably damaging Het
Lrit3 T A 3: 129,788,391 H528L possibly damaging Het
Mia3 A G 1: 183,338,132 L157S probably damaging Het
Naa16 A T 14: 79,384,700 Y32* probably null Het
Nbea A G 3: 56,079,927 Y381H probably damaging Het
Nelfcd T C 2: 174,426,366 V475A probably benign Het
Noxa1 T C 2: 25,086,234 I347M probably benign Het
Olfr131 A T 17: 38,082,283 S232T possibly damaging Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr699 A T 7: 106,790,332 F223Y possibly damaging Het
Olfr747 T A 14: 50,680,702 K311* probably null Het
Pabpc1l T A 2: 164,043,587 I420K probably benign Het
Pi4ka C T 16: 17,281,050 C1990Y probably damaging Het
Pkhd1 T A 1: 20,585,191 Q223L probably damaging Het
Pkm G T 9: 59,668,681 probably null Het
Proz A G 8: 13,066,931 D161G probably damaging Het
Ptprb C A 10: 116,322,459 H765Q probably benign Het
Rffl A T 11: 82,812,793 C101* probably null Het
Rfx5 C T 3: 94,955,140 T36I probably benign Het
Rnase12 C A 14: 51,056,904 C106F probably damaging Het
Samd3 T C 10: 26,263,788 S273P possibly damaging Het
Simc1 A G 13: 54,526,362 D841G probably benign Het
Slc8a3 T C 12: 81,214,134 E607G probably null Het
Snrnp40 G T 4: 130,365,165 G122V possibly damaging Het
Snx25 T C 8: 46,068,166 *143W probably null Het
Taf15 A G 11: 83,487,396 Y154C probably damaging Het
Tgfb3 A G 12: 86,058,982 V333A possibly damaging Het
Tiam1 A G 16: 89,818,041 S2P probably benign Het
Tmed11 T C 5: 108,777,276 probably null Het
Tmtc4 T C 14: 122,932,845 D585G probably damaging Het
Trabd2b T C 4: 114,406,917 S34P probably benign Het
Trbv13-2 T C 6: 41,121,811 Y107H probably damaging Het
Tuba3a A G 6: 125,282,384 V115A probably benign Het
Ubr3 T A 2: 69,938,256 M469K probably damaging Het
Vcan C T 13: 89,657,472 probably benign Het
Wapl C T 14: 34,692,059 Q293* probably null Het
Wdr24 A G 17: 25,824,591 H129R probably damaging Het
Wrn A T 8: 33,267,867 probably null Het
Other mutations in Tut1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Tut1 APN 19 8959096 missense probably damaging 1.00
IGL01934:Tut1 APN 19 8953991 missense probably damaging 1.00
IGL01980:Tut1 APN 19 8954000 missense probably damaging 1.00
IGL02115:Tut1 APN 19 8965312 missense probably damaging 1.00
IGL02375:Tut1 APN 19 8964039 missense probably damaging 1.00
IGL02683:Tut1 APN 19 8965258 missense probably benign 0.31
IGL02899:Tut1 APN 19 8962387 missense probably damaging 1.00
IGL02953:Tut1 APN 19 8962692 missense probably damaging 1.00
PIT4280001:Tut1 UTSW 19 8959262 missense probably benign 0.00
R0014:Tut1 UTSW 19 8962447 missense possibly damaging 0.61
R0014:Tut1 UTSW 19 8962447 missense possibly damaging 0.61
R0033:Tut1 UTSW 19 8962759 missense probably benign 0.03
R0091:Tut1 UTSW 19 8965436 missense probably damaging 0.97
R0173:Tut1 UTSW 19 8965483 nonsense probably null
R0362:Tut1 UTSW 19 8955527 missense possibly damaging 0.94
R0371:Tut1 UTSW 19 8962773 missense probably damaging 0.98
R0386:Tut1 UTSW 19 8955555 missense probably benign 0.00
R1022:Tut1 UTSW 19 8959355 missense probably benign
R1024:Tut1 UTSW 19 8959355 missense probably benign
R1539:Tut1 UTSW 19 8965486 missense probably benign 0.02
R1921:Tut1 UTSW 19 8966102 missense probably benign
R1958:Tut1 UTSW 19 8959313 missense probably damaging 1.00
R2508:Tut1 UTSW 19 8955567 missense probably damaging 0.98
R4757:Tut1 UTSW 19 8959308 missense possibly damaging 0.83
R5185:Tut1 UTSW 19 8955450 missense probably benign 0.07
R6999:Tut1 UTSW 19 8966018 missense probably damaging 1.00
R7084:Tut1 UTSW 19 8965414 missense probably benign
R7091:Tut1 UTSW 19 8965811 missense probably benign
R7313:Tut1 UTSW 19 8964049 missense probably benign 0.00
R7361:Tut1 UTSW 19 8965334 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCTTATCACAGCCCAAGC -3'
(R):5'- GGAGCTCCCCATTCAAGAAC -3'

Sequencing Primer
(F):5'- CACAGCCTTGGGGGACATG -3'
(R):5'- GAGCTCCCCATTCAAGAACATACTC -3'
Posted On2016-06-15