Incidental Mutation 'R5106:Pomk'
ID392629
Institutional Source Beutler Lab
Gene Symbol Pomk
Ensembl Gene ENSMUSG00000037251
Gene Nameprotein-O-mannose kinase
SynonymsSgk196, 4930444A02Rik
MMRRC Submission 042694-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.300) question?
Stock #R5106 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location25980604-25994133 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25986376 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 50 (D50G)
Ref Sequence ENSEMBL: ENSMUSP00000053802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061850]
Predicted Effect probably benign
Transcript: ENSMUST00000061850
AA Change: D50G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000053802
Gene: ENSMUSG00000037251
AA Change: D50G

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Pkinase 80 207 2e-6 PFAM
Pfam:Pkinase_Tyr 80 215 5.9e-11 PFAM
Meta Mutation Damage Score 0.0606 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may be involved in the presentation of the laminin-binding O-linked carbohydrate chain of alpha-dystroglycan (a-DG), which forms transmembrane linkages between the extracellular matrix and the exoskeleton. Some pathogens use this O-linked carbohydrate unit for host entry. Loss of function compound heterozygous mutations in this gene were found in a human patient affected by the Walker-Warburg syndrome (WWS) phenotype. Mice lacking this gene contain misplaced neurons (heterotopia) in some regions of the brain, possibly from defects in neuronal migration. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a gene trap insertion show hydrocephaly and cerebellar dysplasia. Mice also show learning defects, impaired motor strength and decreased sensitivity to pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
C1qtnf2 G A 11: 43,486,053 R84Q possibly damaging Het
Carmil2 T A 8: 105,694,006 probably null Het
Cenpf A T 1: 189,683,808 C107S probably benign Het
Cideb T C 14: 55,754,525 M191V probably benign Het
Cope C A 8: 70,310,447 R213S possibly damaging Het
Ctcf T C 8: 105,681,498 probably benign Het
Daam2 T C 17: 49,476,461 Y647C probably damaging Het
Dlg2 T C 7: 92,442,686 Y920H probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Fdps C A 3: 89,099,403 R127L probably damaging Het
G6pd2 C T 5: 61,810,352 T490I probably benign Het
Gm6401 A G 14: 41,965,506 M121T probably damaging Het
Gnl2 T C 4: 125,053,536 probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtf2a1l A G 17: 88,694,645 S310G possibly damaging Het
H2afy A G 13: 56,088,293 V213A possibly damaging Het
Igdcc4 T C 9: 65,124,701 F500L probably damaging Het
Lgr4 A T 2: 109,997,595 H207L probably damaging Het
Llcfc1 A G 6: 41,685,376 M105V probably benign Het
Map2k3 A G 11: 60,941,882 K18E probably damaging Het
Mccc1 T A 3: 35,972,564 D528V probably benign Het
Nedd4l C T 18: 65,193,305 T568M probably damaging Het
Nr3c1 A C 18: 39,486,601 I211S possibly damaging Het
Nudt5 C T 2: 5,854,829 probably benign Het
Olfr1176 T C 2: 88,340,110 Y182H probably benign Het
Olfr704 T A 7: 106,865,388 M136K probably damaging Het
Olfr771 T C 10: 129,160,237 Y249C probably damaging Het
Olfr826 A T 10: 130,180,308 S191T probably benign Het
Pcid2 A T 8: 13,079,648 F326I probably damaging Het
Pcnt A T 10: 76,401,444 I1336N probably damaging Het
Ppp2r2a T C 14: 67,023,097 Y244C probably damaging Het
Ptprz1 A G 6: 23,000,028 T706A probably benign Het
Rad54l G A 4: 116,099,764 probably benign Het
Raph1 T C 1: 60,533,300 D36G probably damaging Het
Rgs7 A G 1: 175,076,850 S166P possibly damaging Het
Rnf183 C G 4: 62,428,228 R111P probably damaging Het
Rp1l1 A T 14: 64,027,946 D327V probably damaging Het
Rpl3l A G 17: 24,732,437 Y156C probably damaging Het
Slc25a54 G T 3: 109,112,864 C398F probably benign Het
Slc39a2 A G 14: 51,895,531 *310W probably null Het
Slit3 T C 11: 35,612,367 C464R probably damaging Het
Smu1 A T 4: 40,743,104 F345I possibly damaging Het
Ssc5d T A 7: 4,936,665 V700E probably benign Het
Stxbp3 T C 3: 108,794,927 Y521C probably benign Het
Tenm4 T C 7: 96,843,149 S1061P probably damaging Het
Thoc5 T C 11: 4,910,630 S103P probably damaging Het
Tmem221 A G 8: 71,555,878 F173L probably benign Het
Trit1 T C 4: 123,054,313 probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r106 T C 17: 20,279,133 probably null Het
Vmn2r38 C A 7: 9,075,170 V738L possibly damaging Het
Zfp160 T A 17: 21,026,761 H524Q probably damaging Het
Zfp791 T A 8: 85,110,630 K202* probably null Het
Zfp985 T A 4: 147,584,155 S493R probably damaging Het
Zkscan7 T C 9: 122,896,133 probably benign Het
Zwilch A C 9: 64,153,584 F329V probably damaging Het
Other mutations in Pomk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Pomk APN 8 25983596 missense probably benign 0.21
IGL02678:Pomk APN 8 25983107 missense probably damaging 0.97
IGL03090:Pomk APN 8 25983310 missense probably damaging 0.99
R1302:Pomk UTSW 8 25983074 missense probably damaging 1.00
R3105:Pomk UTSW 8 25982914 missense probably damaging 1.00
R4646:Pomk UTSW 8 25983605 missense probably damaging 1.00
R5343:Pomk UTSW 8 25983016 missense probably benign 0.09
R5572:Pomk UTSW 8 25983190 missense possibly damaging 0.88
R5953:Pomk UTSW 8 25983048 missense probably damaging 1.00
R6150:Pomk UTSW 8 25983256 missense possibly damaging 0.89
R6295:Pomk UTSW 8 25982927 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCGTTCTTCCAGCGATGC -3'
(R):5'- AATGGTGCTTGCTACTCATTGTC -3'

Sequencing Primer
(F):5'- AGCAGGAATACTCACTCTC -3'
(R):5'- CTCCTGTTCTGTTGTAGGGACTGAC -3'
Posted On2016-06-15