Incidental Mutation 'R5106:Cope'
ID392630
Institutional Source Beutler Lab
Gene Symbol Cope
Ensembl Gene ENSMUSG00000055681
Gene Namecoatomer protein complex, subunit epsilon
Synonyms1110005D17Rik, Cope1
MMRRC Submission 042694-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R5106 (G1)
Quality Score177
Status Validated
Chromosome8
Chromosomal Location70302518-70312993 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 70310447 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 213 (R213S)
Ref Sequence ENSEMBL: ENSMUSP00000119055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066469] [ENSMUST00000128003] [ENSMUST00000150968] [ENSMUST00000168018]
Predicted Effect probably benign
Transcript: ENSMUST00000066469
AA Change: R231S

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000071078
Gene: ENSMUSG00000055681
AA Change: R231S

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Coatomer_E 15 305 2.8e-134 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128003
AA Change: R147S

PolyPhen 2 Score 0.375 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000122888
Gene: ENSMUSG00000055681
AA Change: R147S

DomainStartEndE-ValueType
Pfam:Coatomer_E 1 212 5.4e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128822
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134822
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140363
Predicted Effect possibly damaging
Transcript: ENSMUST00000150968
AA Change: R213S

PolyPhen 2 Score 0.572 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119055
Gene: ENSMUSG00000055681
AA Change: R213S

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Coatomer_E 15 227 6.5e-86 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000167850
AA Change: R61S
SMART Domains Protein: ENSMUSP00000132976
Gene: ENSMUSG00000055681
AA Change: R61S

DomainStartEndE-ValueType
Pfam:Coatomer_E 1 79 5.4e-38 PFAM
Pfam:Coatomer_E 75 113 3.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168018
SMART Domains Protein: ENSMUSP00000130416
Gene: ENSMUSG00000055681

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Coatomer_E 15 79 4.5e-22 PFAM
Meta Mutation Damage Score 0.2251 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is an epsilon subunit of coatomer protein complex. Coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles. It is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins. Coatomer complex consists of at least the alpha, beta, beta', gamma, delta, epsilon and zeta subunits. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
C1qtnf2 G A 11: 43,486,053 R84Q possibly damaging Het
Carmil2 T A 8: 105,694,006 probably null Het
Cenpf A T 1: 189,683,808 C107S probably benign Het
Cideb T C 14: 55,754,525 M191V probably benign Het
Ctcf T C 8: 105,681,498 probably benign Het
Daam2 T C 17: 49,476,461 Y647C probably damaging Het
Dlg2 T C 7: 92,442,686 Y920H probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Fdps C A 3: 89,099,403 R127L probably damaging Het
G6pd2 C T 5: 61,810,352 T490I probably benign Het
Gm6401 A G 14: 41,965,506 M121T probably damaging Het
Gnl2 T C 4: 125,053,536 probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtf2a1l A G 17: 88,694,645 S310G possibly damaging Het
H2afy A G 13: 56,088,293 V213A possibly damaging Het
Igdcc4 T C 9: 65,124,701 F500L probably damaging Het
Lgr4 A T 2: 109,997,595 H207L probably damaging Het
Llcfc1 A G 6: 41,685,376 M105V probably benign Het
Map2k3 A G 11: 60,941,882 K18E probably damaging Het
Mccc1 T A 3: 35,972,564 D528V probably benign Het
Nedd4l C T 18: 65,193,305 T568M probably damaging Het
Nr3c1 A C 18: 39,486,601 I211S possibly damaging Het
Nudt5 C T 2: 5,854,829 probably benign Het
Olfr1176 T C 2: 88,340,110 Y182H probably benign Het
Olfr704 T A 7: 106,865,388 M136K probably damaging Het
Olfr771 T C 10: 129,160,237 Y249C probably damaging Het
Olfr826 A T 10: 130,180,308 S191T probably benign Het
Pcid2 A T 8: 13,079,648 F326I probably damaging Het
Pcnt A T 10: 76,401,444 I1336N probably damaging Het
Pomk T C 8: 25,986,376 D50G probably benign Het
Ppp2r2a T C 14: 67,023,097 Y244C probably damaging Het
Ptprz1 A G 6: 23,000,028 T706A probably benign Het
Rad54l G A 4: 116,099,764 probably benign Het
Raph1 T C 1: 60,533,300 D36G probably damaging Het
Rgs7 A G 1: 175,076,850 S166P possibly damaging Het
Rnf183 C G 4: 62,428,228 R111P probably damaging Het
Rp1l1 A T 14: 64,027,946 D327V probably damaging Het
Rpl3l A G 17: 24,732,437 Y156C probably damaging Het
Slc25a54 G T 3: 109,112,864 C398F probably benign Het
Slc39a2 A G 14: 51,895,531 *310W probably null Het
Slit3 T C 11: 35,612,367 C464R probably damaging Het
Smu1 A T 4: 40,743,104 F345I possibly damaging Het
Ssc5d T A 7: 4,936,665 V700E probably benign Het
Stxbp3 T C 3: 108,794,927 Y521C probably benign Het
Tenm4 T C 7: 96,843,149 S1061P probably damaging Het
Thoc5 T C 11: 4,910,630 S103P probably damaging Het
Tmem221 A G 8: 71,555,878 F173L probably benign Het
Trit1 T C 4: 123,054,313 probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r106 T C 17: 20,279,133 probably null Het
Vmn2r38 C A 7: 9,075,170 V738L possibly damaging Het
Zfp160 T A 17: 21,026,761 H524Q probably damaging Het
Zfp791 T A 8: 85,110,630 K202* probably null Het
Zfp985 T A 4: 147,584,155 S493R probably damaging Het
Zkscan7 T C 9: 122,896,133 probably benign Het
Zwilch A C 9: 64,153,584 F329V probably damaging Het
Other mutations in Cope
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02696:Cope APN 8 70310493 critical splice donor site probably null
PIT4431001:Cope UTSW 8 70312767 missense probably damaging 0.99
R0570:Cope UTSW 8 70306531 missense probably damaging 0.96
R1382:Cope UTSW 8 70312863 missense probably benign 0.00
R1518:Cope UTSW 8 70312761 missense possibly damaging 0.72
R4538:Cope UTSW 8 70306507 missense probably damaging 1.00
R4941:Cope UTSW 8 70302934 critical splice donor site probably null
R5454:Cope UTSW 8 70304656 missense probably benign 0.17
R5764:Cope UTSW 8 70306581 missense probably damaging 1.00
R5979:Cope UTSW 8 70302543 unclassified probably null
R6003:Cope UTSW 8 70304635 missense probably benign 0.01
R6010:Cope UTSW 8 70308512 missense probably damaging 1.00
R7074:Cope UTSW 8 70312887 missense probably benign 0.11
R8022:Cope UTSW 8 70312803 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TACTCAGGGTTCTCTGCTGG -3'
(R):5'- AGCACACGTGTTTACTGGTC -3'

Sequencing Primer
(F):5'- CCTGAGCTGGTCTAGAGAGAGACTC -3'
(R):5'- TACTGGTCAGGTCATCAACGG -3'
Posted On2016-06-15