Incidental Mutation 'R5106:Ctcf'
ID392633
Institutional Source Beutler Lab
Gene Symbol Ctcf
Ensembl Gene ENSMUSG00000005698
Gene NameCCCTC-binding factor
Synonyms
MMRRC Submission 042694-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5106 (G1)
Quality Score215
Status Validated
Chromosome8
Chromosomal Location105636568-105682922 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 105681498 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005841] [ENSMUST00000213019]
Predicted Effect unknown
Transcript: ENSMUST00000005841
AA Change: V697A
SMART Domains Protein: ENSMUSP00000005841
Gene: ENSMUSG00000005698
AA Change: V697A

DomainStartEndE-ValueType
low complexity region 116 131 N/A INTRINSIC
low complexity region 202 211 N/A INTRINSIC
low complexity region 250 264 N/A INTRINSIC
ZnF_C2H2 266 288 1.22e-4 SMART
ZnF_C2H2 294 316 7.26e-3 SMART
ZnF_C2H2 322 345 6.88e-4 SMART
ZnF_C2H2 351 373 5.14e-3 SMART
ZnF_C2H2 379 401 2.09e-3 SMART
ZnF_C2H2 407 430 2.02e-1 SMART
ZnF_C2H2 437 460 9.44e-2 SMART
ZnF_C2H2 467 489 7.67e-2 SMART
ZnF_C2H2 495 517 3.34e-2 SMART
ZnF_C2H2 523 546 2.53e-2 SMART
ZnF_C2H2 555 575 1.23e1 SMART
low complexity region 592 657 N/A INTRINSIC
low complexity region 700 720 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156436
Predicted Effect probably benign
Transcript: ENSMUST00000213019
Meta Mutation Damage Score 0.0757 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the BORIS + CTCF gene family and encodes a transcriptional regulator protein with 11 highly conserved zinc finger (ZF) domains. This nuclear protein is able to use different combinations of the ZF domains to bind different DNA target sequences and proteins. Depending upon the context of the site, the protein can bind a histone acetyltransferase (HAT)-containing complex and function as a transcriptional activator or bind a histone deacetylase (HDAC)-containing complex and function as a transcriptional repressor. If the protein is bound to a transcriptional insulator element, it can block communication between enhancers and upstream promoters, thereby regulating imprinted expression. Mutations in this gene have been associated with invasive breast cancers, prostate cancers, and Wilms' tumors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a null allele die prior at implantation. Mice homozygous for a conditional allele activated in T cells exhibit a defect in the transition from immature single positive T cells to double positive T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
C1qtnf2 G A 11: 43,486,053 R84Q possibly damaging Het
Carmil2 T A 8: 105,694,006 probably null Het
Cenpf A T 1: 189,683,808 C107S probably benign Het
Cideb T C 14: 55,754,525 M191V probably benign Het
Cope C A 8: 70,310,447 R213S possibly damaging Het
Daam2 T C 17: 49,476,461 Y647C probably damaging Het
Dlg2 T C 7: 92,442,686 Y920H probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Fdps C A 3: 89,099,403 R127L probably damaging Het
G6pd2 C T 5: 61,810,352 T490I probably benign Het
Gm6401 A G 14: 41,965,506 M121T probably damaging Het
Gnl2 T C 4: 125,053,536 probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtf2a1l A G 17: 88,694,645 S310G possibly damaging Het
H2afy A G 13: 56,088,293 V213A possibly damaging Het
Igdcc4 T C 9: 65,124,701 F500L probably damaging Het
Lgr4 A T 2: 109,997,595 H207L probably damaging Het
Llcfc1 A G 6: 41,685,376 M105V probably benign Het
Map2k3 A G 11: 60,941,882 K18E probably damaging Het
Mccc1 T A 3: 35,972,564 D528V probably benign Het
Nedd4l C T 18: 65,193,305 T568M probably damaging Het
Nr3c1 A C 18: 39,486,601 I211S possibly damaging Het
Nudt5 C T 2: 5,854,829 probably benign Het
Olfr1176 T C 2: 88,340,110 Y182H probably benign Het
Olfr704 T A 7: 106,865,388 M136K probably damaging Het
Olfr771 T C 10: 129,160,237 Y249C probably damaging Het
Olfr826 A T 10: 130,180,308 S191T probably benign Het
Pcid2 A T 8: 13,079,648 F326I probably damaging Het
Pcnt A T 10: 76,401,444 I1336N probably damaging Het
Pomk T C 8: 25,986,376 D50G probably benign Het
Ppp2r2a T C 14: 67,023,097 Y244C probably damaging Het
Ptprz1 A G 6: 23,000,028 T706A probably benign Het
Rad54l G A 4: 116,099,764 probably benign Het
Raph1 T C 1: 60,533,300 D36G probably damaging Het
Rgs7 A G 1: 175,076,850 S166P possibly damaging Het
Rnf183 C G 4: 62,428,228 R111P probably damaging Het
Rp1l1 A T 14: 64,027,946 D327V probably damaging Het
Rpl3l A G 17: 24,732,437 Y156C probably damaging Het
Slc25a54 G T 3: 109,112,864 C398F probably benign Het
Slc39a2 A G 14: 51,895,531 *310W probably null Het
Slit3 T C 11: 35,612,367 C464R probably damaging Het
Smu1 A T 4: 40,743,104 F345I possibly damaging Het
Ssc5d T A 7: 4,936,665 V700E probably benign Het
Stxbp3 T C 3: 108,794,927 Y521C probably benign Het
Tenm4 T C 7: 96,843,149 S1061P probably damaging Het
Thoc5 T C 11: 4,910,630 S103P probably damaging Het
Tmem221 A G 8: 71,555,878 F173L probably benign Het
Trit1 T C 4: 123,054,313 probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r106 T C 17: 20,279,133 probably null Het
Vmn2r38 C A 7: 9,075,170 V738L possibly damaging Het
Zfp160 T A 17: 21,026,761 H524Q probably damaging Het
Zfp791 T A 8: 85,110,630 K202* probably null Het
Zfp985 T A 4: 147,584,155 S493R probably damaging Het
Zkscan7 T C 9: 122,896,133 probably benign Het
Zwilch A C 9: 64,153,584 F329V probably damaging Het
Other mutations in Ctcf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Ctcf APN 8 105677336 missense unknown
IGL01068:Ctcf APN 8 105681485 unclassified probably benign
IGL01936:Ctcf APN 8 105670232 missense probably benign 0.21
IGL02010:Ctcf APN 8 105664965 missense probably damaging 1.00
IGL02545:Ctcf APN 8 105664381 missense probably benign 0.39
IGL02617:Ctcf APN 8 105677210 splice site probably benign
R0255:Ctcf UTSW 8 105664039 missense possibly damaging 0.76
R0348:Ctcf UTSW 8 105676157 nonsense probably null
R0497:Ctcf UTSW 8 105675040 splice site probably benign
R1238:Ctcf UTSW 8 105671277 splice site probably benign
R1903:Ctcf UTSW 8 105675988 splice site probably null
R2508:Ctcf UTSW 8 105671384 missense probably damaging 1.00
R4035:Ctcf UTSW 8 105664157 missense possibly damaging 0.52
R4448:Ctcf UTSW 8 105680293 intron probably benign
R6370:Ctcf UTSW 8 105664220 missense probably benign 0.05
R6378:Ctcf UTSW 8 105663791 missense possibly damaging 0.70
R6392:Ctcf UTSW 8 105664133 missense probably damaging 0.97
R6737:Ctcf UTSW 8 105664508 missense probably benign 0.02
R7725:Ctcf UTSW 8 105663836 missense probably damaging 1.00
R7791:Ctcf UTSW 8 105664939 missense possibly damaging 0.47
R7895:Ctcf UTSW 8 105664058 missense possibly damaging 0.95
R7978:Ctcf UTSW 8 105664058 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATCACTGCTGAGGCTTTCTTG -3'
(R):5'- TGCCGTTCCCAAAGCCAAAG -3'

Sequencing Primer
(F):5'- GAGGCTTTCTTGTTGCTGCATCC -3'
(R):5'- TTAAGATTTGGGCCGTTTAAACACAG -3'
Posted On2016-06-15