Incidental Mutation 'R5106:C1qtnf2'
ID392643
Institutional Source Beutler Lab
Gene Symbol C1qtnf2
Ensembl Gene ENSMUSG00000046491
Gene NameC1q and tumor necrosis factor related protein 2
Synonyms1810033K05Rik, CTRP2
MMRRC Submission 042694-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5106 (G1)
Quality Score218
Status Validated
Chromosome11
Chromosomal Location43474276-43491525 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 43486053 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 84 (R84Q)
Ref Sequence ENSEMBL: ENSMUSP00000133616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057679] [ENSMUST00000151912] [ENSMUST00000173002]
Predicted Effect probably benign
Transcript: ENSMUST00000057679
AA Change: R84Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000051652
Gene: ENSMUSG00000046491
AA Change: R84Q

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Collagen 46 104 1.2e-10 PFAM
Pfam:Collagen 90 151 2.1e-11 PFAM
C1Q 152 287 3.96e-46 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000151912
AA Change: R84Q

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133616
Gene: ENSMUSG00000046491
AA Change: R84Q

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Collagen 46 103 6.8e-11 PFAM
Pfam:Collagen 79 137 3.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173002
AA Change: R114Q

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000134705
Gene: ENSMUSG00000046491
AA Change: R114Q

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
Pfam:Collagen 76 135 7.4e-11 PFAM
Pfam:Collagen 121 181 1.9e-11 PFAM
C1Q 182 317 3.96e-46 SMART
Meta Mutation Damage Score 0.0789 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Carmil2 T A 8: 105,694,006 probably null Het
Cenpf A T 1: 189,683,808 C107S probably benign Het
Cideb T C 14: 55,754,525 M191V probably benign Het
Cope C A 8: 70,310,447 R213S possibly damaging Het
Ctcf T C 8: 105,681,498 probably benign Het
Daam2 T C 17: 49,476,461 Y647C probably damaging Het
Dlg2 T C 7: 92,442,686 Y920H probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Fdps C A 3: 89,099,403 R127L probably damaging Het
G6pd2 C T 5: 61,810,352 T490I probably benign Het
Gm6401 A G 14: 41,965,506 M121T probably damaging Het
Gnl2 T C 4: 125,053,536 probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtf2a1l A G 17: 88,694,645 S310G possibly damaging Het
H2afy A G 13: 56,088,293 V213A possibly damaging Het
Igdcc4 T C 9: 65,124,701 F500L probably damaging Het
Lgr4 A T 2: 109,997,595 H207L probably damaging Het
Llcfc1 A G 6: 41,685,376 M105V probably benign Het
Map2k3 A G 11: 60,941,882 K18E probably damaging Het
Mccc1 T A 3: 35,972,564 D528V probably benign Het
Nedd4l C T 18: 65,193,305 T568M probably damaging Het
Nr3c1 A C 18: 39,486,601 I211S possibly damaging Het
Nudt5 C T 2: 5,854,829 probably benign Het
Olfr1176 T C 2: 88,340,110 Y182H probably benign Het
Olfr704 T A 7: 106,865,388 M136K probably damaging Het
Olfr771 T C 10: 129,160,237 Y249C probably damaging Het
Olfr826 A T 10: 130,180,308 S191T probably benign Het
Pcid2 A T 8: 13,079,648 F326I probably damaging Het
Pcnt A T 10: 76,401,444 I1336N probably damaging Het
Pomk T C 8: 25,986,376 D50G probably benign Het
Ppp2r2a T C 14: 67,023,097 Y244C probably damaging Het
Ptprz1 A G 6: 23,000,028 T706A probably benign Het
Rad54l G A 4: 116,099,764 probably benign Het
Raph1 T C 1: 60,533,300 D36G probably damaging Het
Rgs7 A G 1: 175,076,850 S166P possibly damaging Het
Rnf183 C G 4: 62,428,228 R111P probably damaging Het
Rp1l1 A T 14: 64,027,946 D327V probably damaging Het
Rpl3l A G 17: 24,732,437 Y156C probably damaging Het
Slc25a54 G T 3: 109,112,864 C398F probably benign Het
Slc39a2 A G 14: 51,895,531 *310W probably null Het
Slit3 T C 11: 35,612,367 C464R probably damaging Het
Smu1 A T 4: 40,743,104 F345I possibly damaging Het
Ssc5d T A 7: 4,936,665 V700E probably benign Het
Stxbp3 T C 3: 108,794,927 Y521C probably benign Het
Tenm4 T C 7: 96,843,149 S1061P probably damaging Het
Thoc5 T C 11: 4,910,630 S103P probably damaging Het
Tmem221 A G 8: 71,555,878 F173L probably benign Het
Trit1 T C 4: 123,054,313 probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r106 T C 17: 20,279,133 probably null Het
Vmn2r38 C A 7: 9,075,170 V738L possibly damaging Het
Zfp160 T A 17: 21,026,761 H524Q probably damaging Het
Zfp791 T A 8: 85,110,630 K202* probably null Het
Zfp985 T A 4: 147,584,155 S493R probably damaging Het
Zkscan7 T C 9: 122,896,133 probably benign Het
Zwilch A C 9: 64,153,584 F329V probably damaging Het
Other mutations in C1qtnf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00266:C1qtnf2 APN 11 43485999 missense possibly damaging 0.93
IGL03178:C1qtnf2 APN 11 43490989 missense probably damaging 0.98
PIT4305001:C1qtnf2 UTSW 11 43491195 missense probably damaging 1.00
R0226:C1qtnf2 UTSW 11 43490843 missense probably benign
R1412:C1qtnf2 UTSW 11 43491132 missense probably damaging 1.00
R1796:C1qtnf2 UTSW 11 43491287 missense probably damaging 1.00
R2145:C1qtnf2 UTSW 11 43490984 missense probably damaging 1.00
R2504:C1qtnf2 UTSW 11 43491156 missense probably damaging 1.00
R3829:C1qtnf2 UTSW 11 43491321 missense probably benign
R5547:C1qtnf2 UTSW 11 43490967 missense probably damaging 1.00
R5879:C1qtnf2 UTSW 11 43486008 missense probably damaging 0.99
R8138:C1qtnf2 UTSW 11 43486011 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGATCTCCTGGGTACTCTTGG -3'
(R):5'- AAAACTCAGCAGATGGATGGTC -3'

Sequencing Primer
(F):5'- TGTGCTGCTGACCCAATG -3'
(R):5'- GGTCTTCATCTGTTCTCTTCCAATTG -3'
Posted On2016-06-15