Incidental Mutation 'R5106:Slc39a2'
ID392648
Institutional Source Beutler Lab
Gene Symbol Slc39a2
Ensembl Gene ENSMUSG00000072572
Gene Namesolute carrier family 39 (zinc transporter), member 2
Synonymszip2, F730005G13Rik
MMRRC Submission 042694-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R5106 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location51892889-51896745 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 51895531 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 310 (*310W)
Ref Sequence ENSEMBL: ENSMUSP00000038707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047726] [ENSMUST00000047899] [ENSMUST00000164252] [ENSMUST00000164902] [ENSMUST00000165100] [ENSMUST00000165568]
Predicted Effect probably null
Transcript: ENSMUST00000047726
AA Change: *310W
SMART Domains Protein: ENSMUSP00000038707
Gene: ENSMUSG00000072572
AA Change: *310W

DomainStartEndE-ValueType
Pfam:Zip 5 306 1.1e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047899
SMART Domains Protein: ENSMUSP00000047720
Gene: ENSMUSG00000004561

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 63 76 N/A INTRINSIC
Pfam:Rsm22 153 442 8e-65 PFAM
Pfam:Methyltransf_11 191 293 5.9e-7 PFAM
low complexity region 446 460 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163603
Predicted Effect probably benign
Transcript: ENSMUST00000164252
SMART Domains Protein: ENSMUSP00000130038
Gene: ENSMUSG00000004561

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 63 76 N/A INTRINSIC
Pfam:Rsm22 153 235 2.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164902
SMART Domains Protein: ENSMUSP00000130200
Gene: ENSMUSG00000004561

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 63 76 N/A INTRINSIC
Pfam:Rsm22 153 467 1.7e-61 PFAM
Pfam:Methyltransf_11 191 294 3.6e-6 PFAM
low complexity region 471 485 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165100
SMART Domains Protein: ENSMUSP00000132354
Gene: ENSMUSG00000004561

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 63 76 N/A INTRINSIC
Pfam:Rsm22 153 235 2.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165568
SMART Domains Protein: ENSMUSP00000129973
Gene: ENSMUSG00000004561

DomainStartEndE-ValueType
Pfam:Rsm22 100 269 1.5e-37 PFAM
Pfam:Methyltransf_11 138 240 2.1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168413
Meta Mutation Damage Score 0.8636 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ZIP family of metal ion transporters. The encoded protein functions as a zinc transporter. Mutations in this gene may be associated with susceptibility to carotid artery disease. Multiple transcript variants have been described. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a null allele are overtly normal when fed a zinc-replete diet but show increased sensitivity to the effects of maternal dietary zinc deficiency during pregnancy. Resulting embryos are often growth retarded with craniofacial and limb defects, and show altered iron and calcium levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
C1qtnf2 G A 11: 43,486,053 R84Q possibly damaging Het
Carmil2 T A 8: 105,694,006 probably null Het
Cenpf A T 1: 189,683,808 C107S probably benign Het
Cideb T C 14: 55,754,525 M191V probably benign Het
Cope C A 8: 70,310,447 R213S possibly damaging Het
Ctcf T C 8: 105,681,498 probably benign Het
Daam2 T C 17: 49,476,461 Y647C probably damaging Het
Dlg2 T C 7: 92,442,686 Y920H probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Fdps C A 3: 89,099,403 R127L probably damaging Het
G6pd2 C T 5: 61,810,352 T490I probably benign Het
Gm6401 A G 14: 41,965,506 M121T probably damaging Het
Gnl2 T C 4: 125,053,536 probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtf2a1l A G 17: 88,694,645 S310G possibly damaging Het
H2afy A G 13: 56,088,293 V213A possibly damaging Het
Igdcc4 T C 9: 65,124,701 F500L probably damaging Het
Lgr4 A T 2: 109,997,595 H207L probably damaging Het
Llcfc1 A G 6: 41,685,376 M105V probably benign Het
Map2k3 A G 11: 60,941,882 K18E probably damaging Het
Mccc1 T A 3: 35,972,564 D528V probably benign Het
Nedd4l C T 18: 65,193,305 T568M probably damaging Het
Nr3c1 A C 18: 39,486,601 I211S possibly damaging Het
Nudt5 C T 2: 5,854,829 probably benign Het
Olfr1176 T C 2: 88,340,110 Y182H probably benign Het
Olfr704 T A 7: 106,865,388 M136K probably damaging Het
Olfr771 T C 10: 129,160,237 Y249C probably damaging Het
Olfr826 A T 10: 130,180,308 S191T probably benign Het
Pcid2 A T 8: 13,079,648 F326I probably damaging Het
Pcnt A T 10: 76,401,444 I1336N probably damaging Het
Pomk T C 8: 25,986,376 D50G probably benign Het
Ppp2r2a T C 14: 67,023,097 Y244C probably damaging Het
Ptprz1 A G 6: 23,000,028 T706A probably benign Het
Rad54l G A 4: 116,099,764 probably benign Het
Raph1 T C 1: 60,533,300 D36G probably damaging Het
Rgs7 A G 1: 175,076,850 S166P possibly damaging Het
Rnf183 C G 4: 62,428,228 R111P probably damaging Het
Rp1l1 A T 14: 64,027,946 D327V probably damaging Het
Rpl3l A G 17: 24,732,437 Y156C probably damaging Het
Slc25a54 G T 3: 109,112,864 C398F probably benign Het
Slit3 T C 11: 35,612,367 C464R probably damaging Het
Smu1 A T 4: 40,743,104 F345I possibly damaging Het
Ssc5d T A 7: 4,936,665 V700E probably benign Het
Stxbp3 T C 3: 108,794,927 Y521C probably benign Het
Tenm4 T C 7: 96,843,149 S1061P probably damaging Het
Thoc5 T C 11: 4,910,630 S103P probably damaging Het
Tmem221 A G 8: 71,555,878 F173L probably benign Het
Trit1 T C 4: 123,054,313 probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r106 T C 17: 20,279,133 probably null Het
Vmn2r38 C A 7: 9,075,170 V738L possibly damaging Het
Zfp160 T A 17: 21,026,761 H524Q probably damaging Het
Zfp791 T A 8: 85,110,630 K202* probably null Het
Zfp985 T A 4: 147,584,155 S493R probably damaging Het
Zkscan7 T C 9: 122,896,133 probably benign Het
Zwilch A C 9: 64,153,584 F329V probably damaging Het
Other mutations in Slc39a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Slc39a2 APN 14 51895136 nonsense probably null
IGL02421:Slc39a2 APN 14 51893872 missense probably benign 0.00
IGL02546:Slc39a2 APN 14 51895163 missense probably benign 0.16
IGL02823:Slc39a2 APN 14 51895412 missense probably damaging 1.00
R1126:Slc39a2 UTSW 14 51894145 missense probably damaging 1.00
R4923:Slc39a2 UTSW 14 51895254 missense probably damaging 1.00
R6158:Slc39a2 UTSW 14 51894224 unclassified probably null
R7094:Slc39a2 UTSW 14 51893689 unclassified probably benign
R7324:Slc39a2 UTSW 14 51894193 missense possibly damaging 0.74
R7340:Slc39a2 UTSW 14 51894203 missense possibly damaging 0.87
R7578:Slc39a2 UTSW 14 51895416 missense probably damaging 1.00
R7599:Slc39a2 UTSW 14 51895031 missense probably benign 0.10
Z1177:Slc39a2 UTSW 14 51893895 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCTCATGTCTCCTGTGG -3'
(R):5'- ACATTCTTTCTAAGTCCTGAGCAAG -3'

Sequencing Primer
(F):5'- CATGTCTCCTGTGGGCCTAG -3'
(R):5'- GGACAGGATCTCACGTGTATG -3'
Posted On2016-06-15