Incidental Mutation 'R5106:Dnase1l1'
ID392659
Institutional Source Beutler Lab
Gene Symbol Dnase1l1
Ensembl Gene ENSMUSG00000019088
Gene Namedeoxyribonuclease 1-like 1
SynonymsDnase1ll, G4.8, Dnl1ll, 2310005K03Rik
MMRRC Submission 042694-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R5106 (G1)
Quality Score225
Status Validated
ChromosomeX
Chromosomal Location74273217-74282337 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 74277038 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008826] [ENSMUST00000019232] [ENSMUST00000074085] [ENSMUST00000075821] [ENSMUST00000114189] [ENSMUST00000119361] [ENSMUST00000135690] [ENSMUST00000151702]
Predicted Effect probably benign
Transcript: ENSMUST00000008826
SMART Domains Protein: ENSMUSP00000008826
Gene: ENSMUSG00000008682

DomainStartEndE-ValueType
Pfam:Ribosomal_L16 5 167 1.1e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000019232
SMART Domains Protein: ENSMUSP00000019232
Gene: ENSMUSG00000019088

DomainStartEndE-ValueType
DNaseIc 21 289 3.93e-149 SMART
low complexity region 301 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074085
SMART Domains Protein: ENSMUSP00000082055
Gene: ENSMUSG00000008682

DomainStartEndE-ValueType
Pfam:Ribosomal_L16 5 167 1.1e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000075821
SMART Domains Protein: ENSMUSP00000075218
Gene: ENSMUSG00000019088

DomainStartEndE-ValueType
DNaseIc 21 289 3.93e-149 SMART
low complexity region 301 313 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083047
Predicted Effect probably null
Transcript: ENSMUST00000114189
SMART Domains Protein: ENSMUSP00000109827
Gene: ENSMUSG00000019088

DomainStartEndE-ValueType
Blast:DNaseIc 21 70 5e-22 BLAST
SCOP:d2dnja_ 39 79 2e-4 SMART
low complexity region 91 103 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119361
SMART Domains Protein: ENSMUSP00000113515
Gene: ENSMUSG00000019088

DomainStartEndE-ValueType
Blast:DNaseIc 21 64 2e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125775
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135012
Predicted Effect probably benign
Transcript: ENSMUST00000135690
SMART Domains Protein: ENSMUSP00000119500
Gene: ENSMUSG00000008682

DomainStartEndE-ValueType
Pfam:Ribosomal_L16 5 150 1.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149171
Predicted Effect probably benign
Transcript: ENSMUST00000151702
SMART Domains Protein: ENSMUSP00000115919
Gene: ENSMUSG00000008682

DomainStartEndE-ValueType
Pfam:Ribosomal_L16 5 167 1.5e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184075
Meta Mutation Damage Score 0.9711 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a deoxyribonuclease protein that shows high sequence similarity to DNase I. The encoded protein is localized to the endoplasmic reticulum and modified by N-linked glycosylation. Alternate transcriptional splice variants encoding the same protein have been observed. [provided by RefSeq, Jan 2015]
PHENOTYPE: Female mice homozygous for an inactivating mutation of this gene exhibit poor motor coordination on the rotarod even on days 4 and 5 of a 5-day test. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
C1qtnf2 G A 11: 43,486,053 R84Q possibly damaging Het
Carmil2 T A 8: 105,694,006 probably null Het
Cenpf A T 1: 189,683,808 C107S probably benign Het
Cideb T C 14: 55,754,525 M191V probably benign Het
Cope C A 8: 70,310,447 R213S possibly damaging Het
Ctcf T C 8: 105,681,498 probably benign Het
Daam2 T C 17: 49,476,461 Y647C probably damaging Het
Dlg2 T C 7: 92,442,686 Y920H probably damaging Het
Fdps C A 3: 89,099,403 R127L probably damaging Het
G6pd2 C T 5: 61,810,352 T490I probably benign Het
Gm6401 A G 14: 41,965,506 M121T probably damaging Het
Gnl2 T C 4: 125,053,536 probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtf2a1l A G 17: 88,694,645 S310G possibly damaging Het
H2afy A G 13: 56,088,293 V213A possibly damaging Het
Igdcc4 T C 9: 65,124,701 F500L probably damaging Het
Lgr4 A T 2: 109,997,595 H207L probably damaging Het
Llcfc1 A G 6: 41,685,376 M105V probably benign Het
Map2k3 A G 11: 60,941,882 K18E probably damaging Het
Mccc1 T A 3: 35,972,564 D528V probably benign Het
Nedd4l C T 18: 65,193,305 T568M probably damaging Het
Nr3c1 A C 18: 39,486,601 I211S possibly damaging Het
Nudt5 C T 2: 5,854,829 probably benign Het
Olfr1176 T C 2: 88,340,110 Y182H probably benign Het
Olfr704 T A 7: 106,865,388 M136K probably damaging Het
Olfr771 T C 10: 129,160,237 Y249C probably damaging Het
Olfr826 A T 10: 130,180,308 S191T probably benign Het
Pcid2 A T 8: 13,079,648 F326I probably damaging Het
Pcnt A T 10: 76,401,444 I1336N probably damaging Het
Pomk T C 8: 25,986,376 D50G probably benign Het
Ppp2r2a T C 14: 67,023,097 Y244C probably damaging Het
Ptprz1 A G 6: 23,000,028 T706A probably benign Het
Rad54l G A 4: 116,099,764 probably benign Het
Raph1 T C 1: 60,533,300 D36G probably damaging Het
Rgs7 A G 1: 175,076,850 S166P possibly damaging Het
Rnf183 C G 4: 62,428,228 R111P probably damaging Het
Rp1l1 A T 14: 64,027,946 D327V probably damaging Het
Rpl3l A G 17: 24,732,437 Y156C probably damaging Het
Slc25a54 G T 3: 109,112,864 C398F probably benign Het
Slc39a2 A G 14: 51,895,531 *310W probably null Het
Slit3 T C 11: 35,612,367 C464R probably damaging Het
Smu1 A T 4: 40,743,104 F345I possibly damaging Het
Ssc5d T A 7: 4,936,665 V700E probably benign Het
Stxbp3 T C 3: 108,794,927 Y521C probably benign Het
Tenm4 T C 7: 96,843,149 S1061P probably damaging Het
Thoc5 T C 11: 4,910,630 S103P probably damaging Het
Tmem221 A G 8: 71,555,878 F173L probably benign Het
Trit1 T C 4: 123,054,313 probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r106 T C 17: 20,279,133 probably null Het
Vmn2r38 C A 7: 9,075,170 V738L possibly damaging Het
Zfp160 T A 17: 21,026,761 H524Q probably damaging Het
Zfp791 T A 8: 85,110,630 K202* probably null Het
Zfp985 T A 4: 147,584,155 S493R probably damaging Het
Zkscan7 T C 9: 122,896,133 probably benign Het
Zwilch A C 9: 64,153,584 F329V probably damaging Het
Other mutations in Dnase1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4691:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4752:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4753:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4814:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4815:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4846:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4861:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4862:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4872:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4873:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4875:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4978:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4979:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4980:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4981:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4982:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4983:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5039:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5084:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5085:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5086:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5087:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5107:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5108:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5109:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5137:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5171:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5266:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5296:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5330:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5417:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5418:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5419:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5448:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5450:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5466:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5467:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6126:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6128:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6129:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6130:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6232:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6233:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6234:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6242:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6305:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6306:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6329:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6343:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6344:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6396:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6397:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6449:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6450:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6585:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6586:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6646:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6679:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6681:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6845:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6847:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GATTGGTACCAGAGTGGCTG -3'
(R):5'- CTTTGGAGGGTTCCTGATGCAC -3'

Sequencing Primer
(F):5'- TACCAGAGTGGCTGCAGAC -3'
(R):5'- GGTTCCTGATGCACACATAGCAATG -3'
Posted On2016-06-15