Incidental Mutation 'R5117:Cep135'
ID392671
Institutional Source Beutler Lab
Gene Symbol Cep135
Ensembl Gene ENSMUSG00000036403
Gene Namecentrosomal protein 135
SynonymsLOC381644, Cep4
MMRRC Submission 042705-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5117 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location76588698-76646466 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76631429 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 762 (K762R)
Ref Sequence ENSEMBL: ENSMUSP00000112602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049060] [ENSMUST00000121979]
Predicted Effect probably benign
Transcript: ENSMUST00000049060
AA Change: K762R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000038674
Gene: ENSMUSG00000036403
AA Change: K762R

DomainStartEndE-ValueType
internal_repeat_1 47 71 1.87e-5 PROSPERO
low complexity region 78 92 N/A INTRINSIC
internal_repeat_1 100 124 1.87e-5 PROSPERO
coiled coil region 125 153 N/A INTRINSIC
coiled coil region 194 245 N/A INTRINSIC
coiled coil region 267 420 N/A INTRINSIC
coiled coil region 445 470 N/A INTRINSIC
Blast:HAMP 492 527 5e-11 BLAST
Blast:SPEC 760 863 6e-21 BLAST
low complexity region 1060 1072 N/A INTRINSIC
coiled coil region 1075 1117 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121979
AA Change: K762R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000112602
Gene: ENSMUSG00000036403
AA Change: K762R

DomainStartEndE-ValueType
internal_repeat_1 47 71 1.87e-5 PROSPERO
low complexity region 78 92 N/A INTRINSIC
internal_repeat_1 100 124 1.87e-5 PROSPERO
coiled coil region 125 153 N/A INTRINSIC
coiled coil region 194 245 N/A INTRINSIC
coiled coil region 267 420 N/A INTRINSIC
coiled coil region 445 470 N/A INTRINSIC
Blast:HAMP 492 527 5e-11 BLAST
Blast:SPEC 760 863 6e-21 BLAST
low complexity region 1060 1072 N/A INTRINSIC
coiled coil region 1075 1117 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130651
Meta Mutation Damage Score 0.0640 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein, which acts as a scaffolding protein during early centriole biogenesis, and is also required for centriole-centriole cohesion during interphase. Mutations in this gene are associated with autosomal recessive primary microcephaly-8. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik G A 9: 124,293,085 T403I probably benign Het
4921509C19Rik T C 2: 151,472,540 E406G probably benign Het
Abca8b T C 11: 109,966,803 E641G probably damaging Het
Agrn T C 4: 156,185,553 N49S probably benign Het
BC005561 A G 5: 104,520,255 Y881C probably damaging Het
Cacna1b A G 2: 24,732,328 S215P probably damaging Het
Cacna1g T A 11: 94,432,503 I1292F probably damaging Het
Card14 T A 11: 119,338,250 I662N probably damaging Het
Ces1b A G 8: 93,073,209 probably null Het
Erich6 T G 3: 58,623,205 I448L probably benign Het
Fads3 T G 19: 10,041,958 probably null Het
Fam234a A G 17: 26,213,538 F546L probably benign Het
Gm10717 T C 9: 3,025,625 L70S probably benign Het
Gm11787 G T 4: 3,509,524 noncoding transcript Het
Gm5519 A G 19: 33,825,071 *171W probably null Het
Grasp A G 15: 101,230,537 D152G probably damaging Het
Grid2 T C 6: 63,256,933 I26T probably benign Het
Hmcn2 T G 2: 31,458,049 C4902W possibly damaging Het
Hsp90aa1 T C 12: 110,695,264 N106S possibly damaging Het
Il18 A T 9: 50,581,509 N125I possibly damaging Het
Ints9 G T 14: 64,993,091 E156* probably null Het
Kalrn T C 16: 34,033,601 probably null Het
Klkb1 A T 8: 45,289,112 D43E possibly damaging Het
Lipo3 A T 19: 33,559,552 M256K probably benign Het
Lrrc29 T A 8: 105,312,860 R595* probably null Het
Mapk6 C A 9: 75,397,735 M133I possibly damaging Het
Med21 T A 6: 146,647,283 probably benign Het
Myrf T A 19: 10,212,493 E984V probably damaging Het
Naga A C 15: 82,337,456 M28R probably damaging Het
Nphp4 T G 4: 152,524,232 probably null Het
Nr1h4 T C 10: 89,478,422 N295D probably damaging Het
Olfr1408 T C 1: 173,130,917 Q100R possibly damaging Het
Olfr543 T C 7: 102,477,502 M123V probably damaging Het
Olfr702 A T 7: 106,823,662 I288N probably damaging Het
Parp9 C A 16: 35,971,832 probably null Het
Pax4 T C 6: 28,446,279 I72V probably benign Het
Pcdh7 A G 5: 57,721,748 I542V probably benign Het
Pcdhgb7 C T 18: 37,752,886 R370W probably damaging Het
Pik3r1 G A 13: 101,692,236 T18I probably benign Het
Ppara A G 15: 85,777,761 I68V probably benign Het
Ptch2 T A 4: 117,105,949 I211N probably damaging Het
Senp6 G A 9: 80,130,746 V715M probably damaging Het
Serf2 C T 2: 121,450,703 P41L possibly damaging Het
Serpina12 T C 12: 104,037,750 I208V possibly damaging Het
Serpinf2 T C 11: 75,432,500 D460G probably benign Het
Sh3d21 T C 4: 126,151,872 E338G probably damaging Het
Slc7a11 T C 3: 50,379,150 D384G probably damaging Het
Snx15 A G 19: 6,124,151 probably null Het
Supt16 A G 14: 52,183,092 F84L probably damaging Het
Tm9sf2 C A 14: 122,143,501 Q169K probably benign Het
Trim56 A T 5: 137,113,978 V228E probably benign Het
Triqk T A 4: 12,980,390 probably null Het
Ttc21a T A 9: 119,966,565 I1155N possibly damaging Het
Ube3b T G 5: 114,419,631 Y1059D probably damaging Het
Vmn2r14 T C 5: 109,216,095 T652A probably benign Het
Wdr4 A G 17: 31,499,824 V304A probably benign Het
Wwp2 T C 8: 107,554,062 S646P possibly damaging Het
Zfand5 T A 19: 21,279,645 S130T probably benign Het
Zfp599 A T 9: 22,250,100 Y256* probably null Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfyve16 T A 13: 92,505,689 I1209L possibly damaging Het
Other mutations in Cep135
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Cep135 APN 5 76601459 missense probably damaging 0.98
IGL01154:Cep135 APN 5 76606796 splice site probably benign
IGL01323:Cep135 APN 5 76591765 missense probably benign 0.29
IGL01599:Cep135 APN 5 76593347 missense possibly damaging 0.93
IGL01923:Cep135 APN 5 76640982 makesense probably null
IGL02178:Cep135 APN 5 76595474 missense probably damaging 1.00
IGL02276:Cep135 APN 5 76634246 missense probably benign 0.00
IGL02344:Cep135 APN 5 76616821 missense probably benign
IGL02394:Cep135 APN 5 76631471 missense probably benign 0.02
IGL02740:Cep135 APN 5 76638268 critical splice donor site probably null
IGL02832:Cep135 APN 5 76640949 missense probably damaging 0.98
R0026:Cep135 UTSW 5 76606734 nonsense probably null
R0060:Cep135 UTSW 5 76621350 missense probably benign 0.20
R0325:Cep135 UTSW 5 76615743 missense probably damaging 0.98
R0336:Cep135 UTSW 5 76601502 missense probably benign 0.07
R0564:Cep135 UTSW 5 76615710 missense probably damaging 1.00
R0564:Cep135 UTSW 5 76638949 missense probably benign 0.03
R0600:Cep135 UTSW 5 76621305 missense probably benign
R0636:Cep135 UTSW 5 76615657 missense probably benign 0.07
R0704:Cep135 UTSW 5 76630949 missense possibly damaging 0.62
R0835:Cep135 UTSW 5 76615706 missense probably benign 0.40
R1015:Cep135 UTSW 5 76640997 critical splice donor site probably null
R1167:Cep135 UTSW 5 76624637 missense probably damaging 1.00
R1252:Cep135 UTSW 5 76594115 missense possibly damaging 0.67
R1554:Cep135 UTSW 5 76634213 nonsense probably null
R1770:Cep135 UTSW 5 76603195 missense possibly damaging 0.95
R1804:Cep135 UTSW 5 76636932 missense probably benign 0.22
R1968:Cep135 UTSW 5 76624747 missense possibly damaging 0.96
R1987:Cep135 UTSW 5 76597428 missense probably benign 0.00
R1996:Cep135 UTSW 5 76632266 missense probably benign 0.08
R2004:Cep135 UTSW 5 76632329 critical splice donor site probably null
R2178:Cep135 UTSW 5 76631450 missense probably benign 0.00
R2305:Cep135 UTSW 5 76595389 splice site probably benign
R2679:Cep135 UTSW 5 76624660 missense probably benign
R3125:Cep135 UTSW 5 76621363 critical splice donor site probably null
R3623:Cep135 UTSW 5 76624739 missense probably benign 0.00
R4359:Cep135 UTSW 5 76611714 missense possibly damaging 0.47
R4407:Cep135 UTSW 5 76624667 missense probably benign
R4561:Cep135 UTSW 5 76638193 missense possibly damaging 0.95
R4666:Cep135 UTSW 5 76616854 missense probably benign
R4945:Cep135 UTSW 5 76597428 missense probably benign 0.00
R5105:Cep135 UTSW 5 76594092 missense probably benign 0.00
R5176:Cep135 UTSW 5 76637026 missense probably benign 0.04
R5194:Cep135 UTSW 5 76615777 missense probably benign 0.05
R5233:Cep135 UTSW 5 76591843 small deletion probably benign
R5275:Cep135 UTSW 5 76593204 missense possibly damaging 0.94
R5295:Cep135 UTSW 5 76593204 missense possibly damaging 0.94
R5412:Cep135 UTSW 5 76616862 missense probably benign 0.00
R5427:Cep135 UTSW 5 76638202 missense probably benign 0.00
R5801:Cep135 UTSW 5 76630676 missense probably damaging 1.00
R5975:Cep135 UTSW 5 76640890 missense possibly damaging 0.94
R6087:Cep135 UTSW 5 76615791 critical splice donor site probably null
R6176:Cep135 UTSW 5 76624643 missense probably benign
R6210:Cep135 UTSW 5 76624723 missense probably benign 0.15
R6456:Cep135 UTSW 5 76591724 start gained probably benign
R6467:Cep135 UTSW 5 76621340 missense possibly damaging 0.50
R6622:Cep135 UTSW 5 76640968 missense probably benign 0.00
R6650:Cep135 UTSW 5 76633701 missense possibly damaging 0.77
R6838:Cep135 UTSW 5 76632215 missense probably damaging 1.00
R7028:Cep135 UTSW 5 76616848 missense probably benign
R7049:Cep135 UTSW 5 76606738 missense probably benign 0.01
R7095:Cep135 UTSW 5 76594058 missense probably benign 0.10
R7207:Cep135 UTSW 5 76632243 missense probably benign 0.00
R7330:Cep135 UTSW 5 76606745 nonsense probably null
R7369:Cep135 UTSW 5 76593253 missense possibly damaging 0.94
R7741:Cep135 UTSW 5 76630970 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGAGACATGCCAAGATGTG -3'
(R):5'- CAGCAGGACTTGAACAGGTG -3'

Sequencing Primer
(F):5'- CATGCCAAGATGTGACATTAGATG -3'
(R):5'- CTTGAACAGGTGACTATGTAAGCAC -3'
Posted On2016-06-15