Mutagenetix > Incidental Mutation

Incidental Mutation 'R5117:Vmn2r14'

392673

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r14

Ensembl Gene

ENSMUSG00000091059

Gene Name

vomeronasal 2, receptor 14

Synonyms

EG231591

MMRRC Submission

042705-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.447) question?

Stock #

R5117 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

109215502-109224622 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 109216095 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 652 (T652A)

Ref Sequence

ENSEMBL: ENSMUSP00000128015 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170341]

AlphaFold

E9Q759

Predicted Effect

probably benign
Transcript: ENSMUST00000170341
AA Change: T652A

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000128015
Gene: ENSMUSG00000091059
AA Change: T652A

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:ANF_receptor	76	466	8.3e-31	PFAM
Pfam:NCD3G	507	561	1.1e-17	PFAM
Pfam:7tm_3	594	829	1.2e-55	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.5%

Validation Efficiency

100% (67/67)

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	G	A	9: 124,293,085	T403I	probably benign	Het
4921509C19Rik	T	C	2: 151,472,540	E406G	probably benign	Het
Abca8b	T	C	11: 109,966,803	E641G	probably damaging	Het
Agrn	T	C	4: 156,185,553	N49S	probably benign	Het
BC005561	A	G	5: 104,520,255	Y881C	probably damaging	Het
Cacna1b	A	G	2: 24,732,328	S215P	probably damaging	Het
Cacna1g	T	A	11: 94,432,503	I1292F	probably damaging	Het
Card14	T	A	11: 119,338,250	I662N	probably damaging	Het
Cep135	A	G	5: 76,631,429	K762R	probably benign	Het
Ces1b	A	G	8: 93,073,209		probably null	Het
Erich6	T	G	3: 58,623,205	I448L	probably benign	Het
Fads3	T	G	19: 10,041,958		probably null	Het
Fam234a	A	G	17: 26,213,538	F546L	probably benign	Het
Gm10717	T	C	9: 3,025,625	L70S	probably benign	Het
Gm11787	G	T	4: 3,509,524		noncoding transcript	Het
Gm5519	A	G	19: 33,825,071	*171W	probably null	Het
Grasp	A	G	15: 101,230,537	D152G	probably damaging	Het
Grid2	T	C	6: 63,256,933	I26T	probably benign	Het
Hmcn2	T	G	2: 31,458,049	C4902W	possibly damaging	Het
Hsp90aa1	T	C	12: 110,695,264	N106S	possibly damaging	Het
Il18	A	T	9: 50,581,509	N125I	possibly damaging	Het
Ints9	G	T	14: 64,993,091	E156*	probably null	Het
Kalrn	T	C	16: 34,033,601		probably null	Het
Klkb1	A	T	8: 45,289,112	D43E	possibly damaging	Het
Lipo3	A	T	19: 33,559,552	M256K	probably benign	Het
Lrrc29	T	A	8: 105,312,860	R595*	probably null	Het
Mapk6	C	A	9: 75,397,735	M133I	possibly damaging	Het
Med21	T	A	6: 146,647,283		probably benign	Het
Myrf	T	A	19: 10,212,493	E984V	probably damaging	Het
Naga	A	C	15: 82,337,456	M28R	probably damaging	Het
Nphp4	T	G	4: 152,524,232		probably null	Het
Nr1h4	T	C	10: 89,478,422	N295D	probably damaging	Het
Olfr1408	T	C	1: 173,130,917	Q100R	possibly damaging	Het
Olfr543	T	C	7: 102,477,502	M123V	probably damaging	Het
Olfr702	A	T	7: 106,823,662	I288N	probably damaging	Het
Parp9	C	A	16: 35,971,832		probably null	Het
Pax4	T	C	6: 28,446,279	I72V	probably benign	Het
Pcdh7	A	G	5: 57,721,748	I542V	probably benign	Het
Pcdhgb7	C	T	18: 37,752,886	R370W	probably damaging	Het
Pik3r1	G	A	13: 101,692,236	T18I	probably benign	Het
Ppara	A	G	15: 85,777,761	I68V	probably benign	Het
Ptch2	T	A	4: 117,105,949	I211N	probably damaging	Het
Senp6	G	A	9: 80,130,746	V715M	probably damaging	Het
Serf2	C	T	2: 121,450,703	P41L	possibly damaging	Het
Serpina12	T	C	12: 104,037,750	I208V	possibly damaging	Het
Serpinf2	T	C	11: 75,432,500	D460G	probably benign	Het
Sh3d21	T	C	4: 126,151,872	E338G	probably damaging	Het
Slc7a11	T	C	3: 50,379,150	D384G	probably damaging	Het
Snx15	A	G	19: 6,124,151		probably null	Het
Supt16	A	G	14: 52,183,092	F84L	probably damaging	Het
Tm9sf2	C	A	14: 122,143,501	Q169K	probably benign	Het
Trim56	A	T	5: 137,113,978	V228E	probably benign	Het
Triqk	T	A	4: 12,980,390		probably null	Het
Ttc21a	T	A	9: 119,966,565	I1155N	possibly damaging	Het
Ube3b	T	G	5: 114,419,631	Y1059D	probably damaging	Het
Wdr4	A	G	17: 31,499,824	V304A	probably benign	Het
Wwp2	T	C	8: 107,554,062	S646P	possibly damaging	Het
Zfand5	T	A	19: 21,279,645	S130T	probably benign	Het
Zfp599	A	T	9: 22,250,100	Y256*	probably null	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het
Zfyve16	T	A	13: 92,505,689	I1209L	possibly damaging	Het

Other mutations in Vmn2r14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01472:Vmn2r14	APN	5	109216314	nonsense	probably null
IGL01504:Vmn2r14	APN	5	109221419	missense	probably benign	0.01
IGL01828:Vmn2r14	APN	5	109224577	missense	possibly damaging	0.71
IGL02093:Vmn2r14	APN	5	109220409	missense	possibly damaging	0.94
IGL02103:Vmn2r14	APN	5	109224483	missense	probably damaging	0.96
IGL02123:Vmn2r14	APN	5	109220067	missense	probably damaging	1.00
IGL02145:Vmn2r14	APN	5	109220588	nonsense	probably null
IGL02676:Vmn2r14	APN	5	109220016	missense	probably benign	0.03
IGL02720:Vmn2r14	APN	5	109221439	missense	probably damaging	1.00
IGL02877:Vmn2r14	APN	5	109220188	missense	probably damaging	0.99
IGL02974:Vmn2r14	APN	5	109221426	missense	possibly damaging	0.55
IGL03151:Vmn2r14	APN	5	109216394	missense	probably damaging	1.00
IGL03297:Vmn2r14	APN	5	109216107	missense	probably damaging	1.00
IGL03386:Vmn2r14	APN	5	109220484	missense	possibly damaging	0.90
IGL03394:Vmn2r14	APN	5	109219836	missense	probably null	0.83
ANU74:Vmn2r14	UTSW	5	109219044	missense	probably benign	0.00
R0316:Vmn2r14	UTSW	5	109218896	missense	probably benign	0.07
R0755:Vmn2r14	UTSW	5	109216360	missense	possibly damaging	0.81
R1219:Vmn2r14	UTSW	5	109224574	missense	probably benign	0.17
R1321:Vmn2r14	UTSW	5	109216251	missense	probably benign	0.08
R1465:Vmn2r14	UTSW	5	109220329	missense	possibly damaging	0.47
R1465:Vmn2r14	UTSW	5	109220329	missense	possibly damaging	0.47
R1509:Vmn2r14	UTSW	5	109215996	missense	probably benign	0.00
R1551:Vmn2r14	UTSW	5	109221417	missense	probably damaging	1.00
R1628:Vmn2r14	UTSW	5	109219972	missense	probably benign	0.00
R1668:Vmn2r14	UTSW	5	109219047	nonsense	probably null
R2013:Vmn2r14	UTSW	5	109221243	missense	probably benign	0.00
R2201:Vmn2r14	UTSW	5	109218832	splice site	probably null
R2417:Vmn2r14	UTSW	5	109224463	missense	probably benign	0.00
R3029:Vmn2r14	UTSW	5	109215910	missense	probably damaging	1.00
R3120:Vmn2r14	UTSW	5	109224565	missense	probably null	0.00
R3729:Vmn2r14	UTSW	5	109216229	missense	probably damaging	1.00
R3762:Vmn2r14	UTSW	5	109220167	missense	probably benign	0.02
R3943:Vmn2r14	UTSW	5	109216064	missense	probably damaging	1.00
R3944:Vmn2r14	UTSW	5	109216064	missense	probably damaging	1.00
R4222:Vmn2r14	UTSW	5	109216283	missense	probably benign	0.00
R4224:Vmn2r14	UTSW	5	109216283	missense	probably benign	0.00
R4239:Vmn2r14	UTSW	5	109216411	critical splice acceptor site	probably null
R4240:Vmn2r14	UTSW	5	109216411	critical splice acceptor site	probably null
R4782:Vmn2r14	UTSW	5	109221504	missense	probably benign	0.01
R4832:Vmn2r14	UTSW	5	109216110	missense	probably damaging	1.00
R4884:Vmn2r14	UTSW	5	109221518	splice site	probably null
R4896:Vmn2r14	UTSW	5	109220380	missense	probably benign	0.19
R5004:Vmn2r14	UTSW	5	109220380	missense	probably benign	0.19
R5285:Vmn2r14	UTSW	5	109217576	missense	probably damaging	0.98
R5413:Vmn2r14	UTSW	5	109221288	missense	probably benign	0.29
R5569:Vmn2r14	UTSW	5	109220395	missense	probably benign	0.44
R5701:Vmn2r14	UTSW	5	109219950	missense	probably damaging	1.00
R5726:Vmn2r14	UTSW	5	109217620	missense	possibly damaging	0.95
R5763:Vmn2r14	UTSW	5	109215858	missense	possibly damaging	0.49
R5872:Vmn2r14	UTSW	5	109221356	missense	probably benign
R5985:Vmn2r14	UTSW	5	109220216	missense	possibly damaging	0.89
R6268:Vmn2r14	UTSW	5	109221417	missense	possibly damaging	0.87
R6273:Vmn2r14	UTSW	5	109221267	missense	probably benign	0.44
R6409:Vmn2r14	UTSW	5	109216230	missense	probably benign	0.09
R6944:Vmn2r14	UTSW	5	109216059	missense	probably benign	0.22
R6944:Vmn2r14	UTSW	5	109216274	missense	probably benign	0.06
R7608:Vmn2r14	UTSW	5	109221410	missense	probably benign	0.03
R7740:Vmn2r14	UTSW	5	109220458	missense	probably benign	0.41
R7768:Vmn2r14	UTSW	5	109220220	missense	probably benign	0.01
R7804:Vmn2r14	UTSW	5	109220458	missense	probably benign	0.41
R7872:Vmn2r14	UTSW	5	109221353	missense	probably benign	0.02
R7993:Vmn2r14	UTSW	5	109215996	missense	probably benign	0.00
R8006:Vmn2r14	UTSW	5	109220458	missense	probably benign	0.41
R8007:Vmn2r14	UTSW	5	109220458	missense	probably benign	0.41
R8187:Vmn2r14	UTSW	5	109220554	missense	probably benign	0.03
R8369:Vmn2r14	UTSW	5	109221476	missense	probably damaging	1.00
R8463:Vmn2r14	UTSW	5	109221474	missense	probably benign	0.30
R8968:Vmn2r14	UTSW	5	109217667	missense	probably benign	0.01
R9008:Vmn2r14	UTSW	5	109220027	missense	probably benign	0.00
R9030:Vmn2r14	UTSW	5	109220188	missense	probably damaging	0.99
R9039:Vmn2r14	UTSW	5	109220036	nonsense	probably null
R9150:Vmn2r14	UTSW	5	109219917	missense	probably damaging	1.00
R9164:Vmn2r14	UTSW	5	109216221	missense	probably damaging	1.00
R9216:Vmn2r14	UTSW	5	109221246	missense	probably benign	0.01
R9225:Vmn2r14	UTSW	5	109221422	missense	probably damaging	1.00
R9245:Vmn2r14	UTSW	5	109220310	missense	possibly damaging	0.89
R9342:Vmn2r14	UTSW	5	109220562	missense	probably damaging	1.00
R9472:Vmn2r14	UTSW	5	109220096	missense	probably benign	0.00
R9678:Vmn2r14	UTSW	5	109216175	missense	probably damaging	1.00
R9774:Vmn2r14	UTSW	5	109221260	missense	probably benign	0.07
Z1177:Vmn2r14	UTSW	5	109219875	missense	probably benign	0.33

Predicted Primers

PCR Primer
(F):5'- GAGATGTTACTAACCAGATTCCACAG -3'
(R):5'- ATGGCTCTAGGATGCATGGC -3'

Sequencing Primer
(F):5'- TTCCACAGAGAACAAGTTGGAC -3'
(R):5'- TCTAGGATGCATGGCCCTGAC -3'

Posted On

2016-06-15