Incidental Mutation 'R5117:Grid2'
ID 392678
Institutional Source Beutler Lab
Gene Symbol Grid2
Ensembl Gene ENSMUSG00000071424
Gene Name glutamate receptor, ionotropic, delta 2
Synonyms tpr, B230104L07Rik, GluRdelta2
MMRRC Submission 042705-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5117 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 63232860-64681307 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 63233917 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 26 (I26T)
Ref Sequence ENSEMBL: ENSMUSP00000093536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095852]
AlphaFold Q61625
Predicted Effect probably benign
Transcript: ENSMUST00000095852
AA Change: I26T

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000093536
Gene: ENSMUSG00000071424
AA Change: I26T

DomainStartEndE-ValueType
Pfam:ANF_receptor 39 404 4.1e-41 PFAM
PBPe 442 807 5.98e-108 SMART
Lig_chan-Glu_bd 452 514 3.76e-24 SMART
transmembrane domain 830 852 N/A INTRINSIC
low complexity region 945 956 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159561
SMART Domains Protein: ENSMUSP00000125402
Gene: ENSMUSG00000071424

DomainStartEndE-ValueType
Pfam:ANF_receptor 39 404 2.7e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161105
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203667
Meta Mutation Damage Score 0.0645 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the family of ionotropic glutamate receptors which are the predominant excitatory neurotransmitter receptors in the mammalian brain. The encoded protein is a multi-pass membrane protein that is expressed selectively in cerebellar Purkinje cells. A point mutation in the mouse ortholog, associated with the phenotype named 'lurcher', in the heterozygous state leads to ataxia resulting from selective, cell-autonomous apoptosis of cerebellar Purkinje cells during postnatal development. Mice homozygous for this mutation die shortly after birth from massive loss of mid- and hindbrain neurons during late embryogenesis. This protein also plays a role in synapse organization between parallel fibers and Purkinje cells. Alternate splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause cerebellar ataxia in humans. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygotes for multiple spontaneous and targeted null mutations exhibit ataxia and impaired locomotion associated with cerebellar Purkinje cell abnormalities and loss, and on some backgrounds, male infertility due to lack of zona penetration by sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik G A 9: 124,055,715 (GRCm39) T403I probably benign Het
4921509C19Rik T C 2: 151,314,460 (GRCm39) E406G probably benign Het
Abca8b T C 11: 109,857,629 (GRCm39) E641G probably damaging Het
Agrn T C 4: 156,270,010 (GRCm39) N49S probably benign Het
Cacna1b A G 2: 24,622,340 (GRCm39) S215P probably damaging Het
Cacna1g T A 11: 94,323,329 (GRCm39) I1292F probably damaging Het
Card14 T A 11: 119,229,076 (GRCm39) I662N probably damaging Het
Cep135 A G 5: 76,779,276 (GRCm39) K762R probably benign Het
Ces1b A G 8: 93,799,837 (GRCm39) probably null Het
Erich6 T G 3: 58,530,626 (GRCm39) I448L probably benign Het
Fads3 T G 19: 10,019,322 (GRCm39) probably null Het
Fam234a A G 17: 26,432,512 (GRCm39) F546L probably benign Het
Fbxl9 T A 8: 106,039,492 (GRCm39) R595* probably null Het
Gm10717 T C 9: 3,025,625 (GRCm39) L70S probably benign Het
Gm11787 G T 4: 3,509,524 (GRCm39) noncoding transcript Het
Gm5519 A G 19: 33,802,471 (GRCm39) *171W probably null Het
Hmcn2 T G 2: 31,348,061 (GRCm39) C4902W possibly damaging Het
Hsp90aa1 T C 12: 110,661,698 (GRCm39) N106S possibly damaging Het
Il18 A T 9: 50,492,809 (GRCm39) N125I possibly damaging Het
Ints9 G T 14: 65,230,540 (GRCm39) E156* probably null Het
Kalrn T C 16: 33,853,971 (GRCm39) probably null Het
Klkb1 A T 8: 45,742,149 (GRCm39) D43E possibly damaging Het
Lipo3 A T 19: 33,536,952 (GRCm39) M256K probably benign Het
Mapk6 C A 9: 75,305,017 (GRCm39) M133I possibly damaging Het
Med21 T A 6: 146,548,781 (GRCm39) probably benign Het
Myrf T A 19: 10,189,857 (GRCm39) E984V probably damaging Het
Naga A C 15: 82,221,657 (GRCm39) M28R probably damaging Het
Nphp4 T G 4: 152,608,689 (GRCm39) probably null Het
Nr1h4 T C 10: 89,314,284 (GRCm39) N295D probably damaging Het
Or10j27 T C 1: 172,958,484 (GRCm39) Q100R possibly damaging Het
Or13n4 A T 7: 106,422,869 (GRCm39) I288N probably damaging Het
Or55b3 T C 7: 102,126,709 (GRCm39) M123V probably damaging Het
Parp9 C A 16: 35,792,202 (GRCm39) probably null Het
Pax4 T C 6: 28,446,278 (GRCm39) I72V probably benign Het
Pcdh7 A G 5: 57,879,090 (GRCm39) I542V probably benign Het
Pcdhgb7 C T 18: 37,885,939 (GRCm39) R370W probably damaging Het
Pik3r1 G A 13: 101,828,744 (GRCm39) T18I probably benign Het
Ppara A G 15: 85,661,962 (GRCm39) I68V probably benign Het
Ptch2 T A 4: 116,963,146 (GRCm39) I211N probably damaging Het
Senp6 G A 9: 80,038,028 (GRCm39) V715M probably damaging Het
Serf2 C T 2: 121,281,184 (GRCm39) P41L possibly damaging Het
Serpina12 T C 12: 104,004,009 (GRCm39) I208V possibly damaging Het
Serpinf2 T C 11: 75,323,326 (GRCm39) D460G probably benign Het
Sh3d21 T C 4: 126,045,665 (GRCm39) E338G probably damaging Het
Slc7a11 T C 3: 50,333,599 (GRCm39) D384G probably damaging Het
Snx15 A G 19: 6,174,181 (GRCm39) probably null Het
Supt16 A G 14: 52,420,549 (GRCm39) F84L probably damaging Het
Tamalin A G 15: 101,128,418 (GRCm39) D152G probably damaging Het
Thoc2l A G 5: 104,668,121 (GRCm39) Y881C probably damaging Het
Tm9sf2 C A 14: 122,380,913 (GRCm39) Q169K probably benign Het
Trim56 A T 5: 137,142,832 (GRCm39) V228E probably benign Het
Triqk T A 4: 12,980,390 (GRCm39) probably null Het
Ttc21a T A 9: 119,795,631 (GRCm39) I1155N possibly damaging Het
Ube3b T G 5: 114,557,692 (GRCm39) Y1059D probably damaging Het
Vmn2r14 T C 5: 109,363,961 (GRCm39) T652A probably benign Het
Wdr4 A G 17: 31,718,798 (GRCm39) V304A probably benign Het
Wwp2 T C 8: 108,280,694 (GRCm39) S646P possibly damaging Het
Zfand5 T A 19: 21,257,009 (GRCm39) S130T probably benign Het
Zfp599 A T 9: 22,161,396 (GRCm39) Y256* probably null Het
Zfp703 C T 8: 27,469,233 (GRCm39) P299L probably damaging Het
Zfyve16 T A 13: 92,642,197 (GRCm39) I1209L possibly damaging Het
Other mutations in Grid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Grid2 APN 6 64,322,573 (GRCm39) missense probably damaging 1.00
IGL00596:Grid2 APN 6 64,510,688 (GRCm39) missense possibly damaging 0.93
IGL01686:Grid2 APN 6 64,297,180 (GRCm39) missense probably benign 0.00
IGL01712:Grid2 APN 6 64,642,899 (GRCm39) missense possibly damaging 0.73
IGL02064:Grid2 APN 6 64,040,919 (GRCm39) missense probably benign 0.29
IGL02216:Grid2 APN 6 64,322,650 (GRCm39) missense probably damaging 0.96
IGL02563:Grid2 APN 6 64,322,857 (GRCm39) missense possibly damaging 0.94
IGL02685:Grid2 APN 6 64,322,800 (GRCm39) missense possibly damaging 0.50
IGL03129:Grid2 APN 6 64,040,888 (GRCm39) missense probably damaging 0.98
IGL03324:Grid2 APN 6 64,406,806 (GRCm39) missense possibly damaging 0.88
IGL03395:Grid2 APN 6 63,886,053 (GRCm39) missense possibly damaging 0.94
crawler UTSW 6 64,406,678 (GRCm39) nonsense probably null
swagger UTSW 6 64,372,263 (GRCm39) synonymous probably benign
R0133:Grid2 UTSW 6 64,297,116 (GRCm39) missense probably damaging 1.00
R0147:Grid2 UTSW 6 64,510,571 (GRCm39) missense probably benign
R0193:Grid2 UTSW 6 64,040,937 (GRCm39) missense possibly damaging 0.64
R0370:Grid2 UTSW 6 64,322,718 (GRCm39) missense possibly damaging 0.75
R0399:Grid2 UTSW 6 64,643,036 (GRCm39) missense probably benign 0.33
R0600:Grid2 UTSW 6 63,480,419 (GRCm39) missense probably benign 0.38
R0717:Grid2 UTSW 6 64,643,259 (GRCm39) missense possibly damaging 0.96
R1524:Grid2 UTSW 6 64,406,738 (GRCm39) missense possibly damaging 0.92
R1555:Grid2 UTSW 6 64,406,668 (GRCm39) missense possibly damaging 0.87
R1572:Grid2 UTSW 6 64,406,678 (GRCm39) nonsense probably null
R1762:Grid2 UTSW 6 64,510,638 (GRCm39) missense probably damaging 0.98
R1944:Grid2 UTSW 6 63,886,045 (GRCm39) missense probably damaging 1.00
R1961:Grid2 UTSW 6 63,885,877 (GRCm39) missense probably damaging 1.00
R1969:Grid2 UTSW 6 63,885,902 (GRCm39) nonsense probably null
R2138:Grid2 UTSW 6 64,322,782 (GRCm39) missense probably damaging 0.99
R3500:Grid2 UTSW 6 63,480,383 (GRCm39) missense probably damaging 0.97
R3547:Grid2 UTSW 6 64,297,005 (GRCm39) missense probably damaging 0.97
R3845:Grid2 UTSW 6 64,322,826 (GRCm39) missense possibly damaging 0.62
R4124:Grid2 UTSW 6 63,480,417 (GRCm39) missense probably benign 0.41
R4273:Grid2 UTSW 6 63,886,029 (GRCm39) missense probably damaging 1.00
R4591:Grid2 UTSW 6 64,297,086 (GRCm39) missense probably damaging 1.00
R4701:Grid2 UTSW 6 64,642,899 (GRCm39) missense probably benign 0.27
R4721:Grid2 UTSW 6 64,643,185 (GRCm39) missense probably benign 0.33
R4755:Grid2 UTSW 6 63,885,972 (GRCm39) missense probably benign 0.04
R4869:Grid2 UTSW 6 64,406,724 (GRCm39) missense probably damaging 1.00
R5083:Grid2 UTSW 6 64,297,136 (GRCm39) nonsense probably null
R5091:Grid2 UTSW 6 64,053,862 (GRCm39) missense probably benign 0.07
R5128:Grid2 UTSW 6 64,642,982 (GRCm39) missense probably benign 0.01
R5386:Grid2 UTSW 6 63,908,089 (GRCm39) missense probably damaging 0.99
R5404:Grid2 UTSW 6 63,907,894 (GRCm39) missense probably damaging 0.99
R5534:Grid2 UTSW 6 63,480,345 (GRCm39) missense probably benign
R5626:Grid2 UTSW 6 64,053,929 (GRCm39) critical splice donor site probably null
R5699:Grid2 UTSW 6 63,885,975 (GRCm39) missense probably damaging 0.99
R5700:Grid2 UTSW 6 64,071,416 (GRCm39) missense possibly damaging 0.95
R5876:Grid2 UTSW 6 64,640,146 (GRCm39) missense probably damaging 1.00
R6446:Grid2 UTSW 6 64,322,577 (GRCm39) missense probably damaging 1.00
R6694:Grid2 UTSW 6 63,908,031 (GRCm39) missense possibly damaging 0.92
R6697:Grid2 UTSW 6 63,908,031 (GRCm39) missense possibly damaging 0.92
R6699:Grid2 UTSW 6 63,908,031 (GRCm39) missense possibly damaging 0.92
R6767:Grid2 UTSW 6 63,907,999 (GRCm39) missense probably benign 0.01
R6895:Grid2 UTSW 6 64,372,283 (GRCm39) missense probably damaging 0.99
R6999:Grid2 UTSW 6 64,053,893 (GRCm39) missense possibly damaging 0.80
R7053:Grid2 UTSW 6 64,677,402 (GRCm39) missense unknown
R7126:Grid2 UTSW 6 64,053,794 (GRCm39) missense probably damaging 0.99
R7432:Grid2 UTSW 6 64,252,854 (GRCm39) missense possibly damaging 0.46
R7553:Grid2 UTSW 6 64,053,925 (GRCm39) missense possibly damaging 0.95
R7619:Grid2 UTSW 6 63,908,085 (GRCm39) missense possibly damaging 0.71
R7997:Grid2 UTSW 6 64,297,120 (GRCm39) missense possibly damaging 0.89
R8112:Grid2 UTSW 6 63,885,891 (GRCm39) missense probably damaging 0.99
R8296:Grid2 UTSW 6 63,233,929 (GRCm39) critical splice donor site probably null
R8320:Grid2 UTSW 6 63,233,917 (GRCm39) missense probably benign 0.15
R8467:Grid2 UTSW 6 64,510,635 (GRCm39) missense probably benign 0.01
R8691:Grid2 UTSW 6 63,480,321 (GRCm39) missense probably damaging 0.97
R8890:Grid2 UTSW 6 63,233,923 (GRCm39) missense probably benign
R8965:Grid2 UTSW 6 64,296,990 (GRCm39) missense probably damaging 1.00
R8968:Grid2 UTSW 6 64,643,139 (GRCm39) missense probably benign 0.14
R9220:Grid2 UTSW 6 63,885,888 (GRCm39) missense probably damaging 1.00
R9371:Grid2 UTSW 6 64,677,506 (GRCm39) missense unknown
R9653:Grid2 UTSW 6 63,907,968 (GRCm39) missense possibly damaging 0.75
Z1176:Grid2 UTSW 6 64,640,212 (GRCm39) missense probably benign 0.03
Z1176:Grid2 UTSW 6 63,885,863 (GRCm39) missense possibly damaging 0.76
Z1177:Grid2 UTSW 6 64,322,841 (GRCm39) missense probably damaging 1.00
Z1177:Grid2 UTSW 6 64,322,840 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTGACCAGAAAAGATTGTGCTG -3'
(R):5'- TCAGTCACTGCTTAGGGAAAG -3'

Sequencing Primer
(F):5'- GGGGAAAGCTGCACTCAACTC -3'
(R):5'- CTTAGGGAAAGCTGAGCCC -3'
Posted On 2016-06-15