Incidental Mutation 'R5117:Ces1b'
ID392684
Institutional Source Beutler Lab
Gene Symbol Ces1b
Ensembl Gene ENSMUSG00000078964
Gene Namecarboxylesterase 1B
SynonymsGm5158
MMRRC Submission 042705-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R5117 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location93056728-93080017 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 93073209 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109582]
Predicted Effect probably null
Transcript: ENSMUST00000109582
SMART Domains Protein: ENSMUSP00000105210
Gene: ENSMUSG00000078964

DomainStartEndE-ValueType
Pfam:COesterase 1 547 7.6e-168 PFAM
Pfam:Abhydrolase_3 136 245 8.5e-11 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik G A 9: 124,293,085 T403I probably benign Het
4921509C19Rik T C 2: 151,472,540 E406G probably benign Het
Abca8b T C 11: 109,966,803 E641G probably damaging Het
Agrn T C 4: 156,185,553 N49S probably benign Het
BC005561 A G 5: 104,520,255 Y881C probably damaging Het
Cacna1b A G 2: 24,732,328 S215P probably damaging Het
Cacna1g T A 11: 94,432,503 I1292F probably damaging Het
Card14 T A 11: 119,338,250 I662N probably damaging Het
Cep135 A G 5: 76,631,429 K762R probably benign Het
Erich6 T G 3: 58,623,205 I448L probably benign Het
Fads3 T G 19: 10,041,958 probably null Het
Fam234a A G 17: 26,213,538 F546L probably benign Het
Gm10717 T C 9: 3,025,625 L70S probably benign Het
Gm11787 G T 4: 3,509,524 noncoding transcript Het
Gm5519 A G 19: 33,825,071 *171W probably null Het
Grasp A G 15: 101,230,537 D152G probably damaging Het
Grid2 T C 6: 63,256,933 I26T probably benign Het
Hmcn2 T G 2: 31,458,049 C4902W possibly damaging Het
Hsp90aa1 T C 12: 110,695,264 N106S possibly damaging Het
Il18 A T 9: 50,581,509 N125I possibly damaging Het
Ints9 G T 14: 64,993,091 E156* probably null Het
Kalrn T C 16: 34,033,601 probably null Het
Klkb1 A T 8: 45,289,112 D43E possibly damaging Het
Lipo3 A T 19: 33,559,552 M256K probably benign Het
Lrrc29 T A 8: 105,312,860 R595* probably null Het
Mapk6 C A 9: 75,397,735 M133I possibly damaging Het
Med21 T A 6: 146,647,283 probably benign Het
Myrf T A 19: 10,212,493 E984V probably damaging Het
Naga A C 15: 82,337,456 M28R probably damaging Het
Nphp4 T G 4: 152,524,232 probably null Het
Nr1h4 T C 10: 89,478,422 N295D probably damaging Het
Olfr1408 T C 1: 173,130,917 Q100R possibly damaging Het
Olfr543 T C 7: 102,477,502 M123V probably damaging Het
Olfr702 A T 7: 106,823,662 I288N probably damaging Het
Parp9 C A 16: 35,971,832 probably null Het
Pax4 T C 6: 28,446,279 I72V probably benign Het
Pcdh7 A G 5: 57,721,748 I542V probably benign Het
Pcdhgb7 C T 18: 37,752,886 R370W probably damaging Het
Pik3r1 G A 13: 101,692,236 T18I probably benign Het
Ppara A G 15: 85,777,761 I68V probably benign Het
Ptch2 T A 4: 117,105,949 I211N probably damaging Het
Senp6 G A 9: 80,130,746 V715M probably damaging Het
Serf2 C T 2: 121,450,703 P41L possibly damaging Het
Serpina12 T C 12: 104,037,750 I208V possibly damaging Het
Serpinf2 T C 11: 75,432,500 D460G probably benign Het
Sh3d21 T C 4: 126,151,872 E338G probably damaging Het
Slc7a11 T C 3: 50,379,150 D384G probably damaging Het
Snx15 A G 19: 6,124,151 probably null Het
Supt16 A G 14: 52,183,092 F84L probably damaging Het
Tm9sf2 C A 14: 122,143,501 Q169K probably benign Het
Trim56 A T 5: 137,113,978 V228E probably benign Het
Triqk T A 4: 12,980,390 probably null Het
Ttc21a T A 9: 119,966,565 I1155N possibly damaging Het
Ube3b T G 5: 114,419,631 Y1059D probably damaging Het
Vmn2r14 T C 5: 109,216,095 T652A probably benign Het
Wdr4 A G 17: 31,499,824 V304A probably benign Het
Wwp2 T C 8: 107,554,062 S646P possibly damaging Het
Zfand5 T A 19: 21,279,645 S130T probably benign Het
Zfp599 A T 9: 22,250,100 Y256* probably null Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfyve16 T A 13: 92,505,689 I1209L possibly damaging Het
Other mutations in Ces1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Ces1b APN 8 93071994 missense probably damaging 0.98
IGL01939:Ces1b APN 8 93079431 missense probably damaging 1.00
IGL02314:Ces1b APN 8 93064896 missense possibly damaging 0.95
IGL02338:Ces1b APN 8 93057047 missense possibly damaging 0.77
IGL02647:Ces1b APN 8 93057044 missense probably benign 0.00
IGL02833:Ces1b APN 8 93079410 missense probably damaging 1.00
IGL03038:Ces1b APN 8 93067052 missense probably benign
IGL03149:Ces1b APN 8 93064874 splice site probably benign
FR4548:Ces1b UTSW 8 93068092 missense probably null
IGL02802:Ces1b UTSW 8 93056966 missense possibly damaging 0.64
R0382:Ces1b UTSW 8 93076052 splice site probably benign
R0893:Ces1b UTSW 8 93079428 missense probably benign 0.11
R0959:Ces1b UTSW 8 93068147 missense probably damaging 1.00
R1386:Ces1b UTSW 8 93068077 missense probably benign 0.02
R1440:Ces1b UTSW 8 93068108 missense probably damaging 0.97
R1667:Ces1b UTSW 8 93056904 missense possibly damaging 0.75
R2113:Ces1b UTSW 8 93068155 missense probably benign
R2193:Ces1b UTSW 8 93079877 missense probably benign 0.00
R2508:Ces1b UTSW 8 93073341 missense possibly damaging 0.75
R4656:Ces1b UTSW 8 93057414 missense probably damaging 0.96
R4776:Ces1b UTSW 8 93063030 missense possibly damaging 0.92
R5108:Ces1b UTSW 8 93071913 missense probably damaging 1.00
R5308:Ces1b UTSW 8 93067017 missense probably benign 0.00
R5381:Ces1b UTSW 8 93065019 missense probably benign 0.02
R5392:Ces1b UTSW 8 93071962 missense probably damaging 0.98
R5614:Ces1b UTSW 8 93068208 missense probably benign 0.00
R5816:Ces1b UTSW 8 93073262 missense probably benign 0.05
R6554:Ces1b UTSW 8 93064991 missense probably benign 0.03
R6576:Ces1b UTSW 8 93056919 missense probably benign 0.06
R6601:Ces1b UTSW 8 93079481 missense probably benign
R6662:Ces1b UTSW 8 93064069 missense probably benign 0.33
R6753:Ces1b UTSW 8 93067020 nonsense probably null
R6904:Ces1b UTSW 8 93060410 missense probably damaging 0.96
R7267:Ces1b UTSW 8 93079504 missense possibly damaging 0.58
R7371:Ces1b UTSW 8 93057354 critical splice donor site probably null
R7396:Ces1b UTSW 8 93063129 missense probably benign 0.00
R7992:Ces1b UTSW 8 93060359 missense probably benign 0.34
R8022:Ces1b UTSW 8 93069315 critical splice donor site probably null
X0024:Ces1b UTSW 8 93063017 missense probably benign
Z1088:Ces1b UTSW 8 93064966 missense probably damaging 0.96
Z1177:Ces1b UTSW 8 93076154 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCCAGGCTAGAGTTCTCAC -3'
(R):5'- TGGTTTGATCAATGACCTCCAGTC -3'

Sequencing Primer
(F):5'- CTCCTAAGTCCTCTACCAAAGATTG -3'
(R):5'- AGTGGCCCCAAATCTTCAATCTACTG -3'
Posted On2016-06-15