Mutagenetix > Incidental Mutation

Incidental Mutation 'R5117:Hsp90aa1'

392700

Institutional Source

Beutler Lab

Gene Symbol

Hsp90aa1

Ensembl Gene

ENSMUSG00000021270

Gene Name

heat shock protein 90, alpha (cytosolic), class A member 1

Synonyms

hsp4, Hspca, Hsp90, Hsp86-1, Hsp89

MMRRC Submission

042705-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5117 (G1)

Quality Score

168

Status

Validated

Chromosome

Chromosomal Location

110690605-110702728 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 110695264 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 106 (N106S)

Ref Sequence

ENSEMBL: ENSMUSP00000118189 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021698] [ENSMUST00000094361] [ENSMUST00000124156] [ENSMUST00000149189] [ENSMUST00000155242]

AlphaFold

P07901

Predicted Effect

unknown
Transcript: ENSMUST00000021698
AA Change: N106S

SMART Domains

Protein: ENSMUSP00000021698
Gene: ENSMUSG00000021270
AA Change: N106S

Domain	Start	End	E-Value	Type
HATPase_c	40	194	2.94e-11	SMART
Pfam:HSP90	196	733	6.7e-272	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000094361
AA Change: N106S

SMART Domains

Protein: ENSMUSP00000091921
Gene: ENSMUSG00000021270
AA Change: N106S

Domain	Start	End	E-Value	Type
HATPase_c	40	194	2.94e-11	SMART
Pfam:HSP90	196	728	2e-245	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000124156

SMART Domains

Protein: ENSMUSP00000121138
Gene: ENSMUSG00000021270

Domain	Start	End	E-Value	Type
PDB:3HHU\|B	1	103	1e-69	PDB
SCOP:d1byqa_	11	103	5e-48	SMART
Blast:HATPase_c	40	103	7e-39	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129005

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134967

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145255

Predicted Effect

probably benign
Transcript: ENSMUST00000149189

SMART Domains

Protein: ENSMUSP00000114201
Gene: ENSMUSG00000021270

Domain	Start	End	E-Value	Type
PDB:3HHU\|B	1	98	6e-66	PDB
SCOP:d1byqa_	11	98	2e-45	SMART
Blast:HATPase_c	40	98	2e-35	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000155242
AA Change: N106S

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000118189
Gene: ENSMUSG00000021270
AA Change: N106S

Domain	Start	End	E-Value	Type
HATPase_c	40	194	2.94e-11	SMART

Meta Mutation Damage Score

0.3902

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.5%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inducible molecular chaperone that functions as a homodimer. The encoded protein aids in the proper folding of specific target proteins by use of an ATPase activity that is modulated by co-chaperones. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit male sterility associated with arrested male meiosis and male germ cell apoptosis. Mice homozygous for a transgenic gene disruption exhibit male sterility and small testis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	G	A	9: 124,293,085	T403I	probably benign	Het
4921509C19Rik	T	C	2: 151,472,540	E406G	probably benign	Het
Abca8b	T	C	11: 109,966,803	E641G	probably damaging	Het
Agrn	T	C	4: 156,185,553	N49S	probably benign	Het
BC005561	A	G	5: 104,520,255	Y881C	probably damaging	Het
Cacna1b	A	G	2: 24,732,328	S215P	probably damaging	Het
Cacna1g	T	A	11: 94,432,503	I1292F	probably damaging	Het
Card14	T	A	11: 119,338,250	I662N	probably damaging	Het
Cep135	A	G	5: 76,631,429	K762R	probably benign	Het
Ces1b	A	G	8: 93,073,209		probably null	Het
Erich6	T	G	3: 58,623,205	I448L	probably benign	Het
Fads3	T	G	19: 10,041,958		probably null	Het
Fam234a	A	G	17: 26,213,538	F546L	probably benign	Het
Gm10717	T	C	9: 3,025,625	L70S	probably benign	Het
Gm11787	G	T	4: 3,509,524		noncoding transcript	Het
Gm5519	A	G	19: 33,825,071	*171W	probably null	Het
Grasp	A	G	15: 101,230,537	D152G	probably damaging	Het
Grid2	T	C	6: 63,256,933	I26T	probably benign	Het
Hmcn2	T	G	2: 31,458,049	C4902W	possibly damaging	Het
Il18	A	T	9: 50,581,509	N125I	possibly damaging	Het
Ints9	G	T	14: 64,993,091	E156*	probably null	Het
Kalrn	T	C	16: 34,033,601		probably null	Het
Klkb1	A	T	8: 45,289,112	D43E	possibly damaging	Het
Lipo3	A	T	19: 33,559,552	M256K	probably benign	Het
Lrrc29	T	A	8: 105,312,860	R595*	probably null	Het
Mapk6	C	A	9: 75,397,735	M133I	possibly damaging	Het
Med21	T	A	6: 146,647,283		probably benign	Het
Myrf	T	A	19: 10,212,493	E984V	probably damaging	Het
Naga	A	C	15: 82,337,456	M28R	probably damaging	Het
Nphp4	T	G	4: 152,524,232		probably null	Het
Nr1h4	T	C	10: 89,478,422	N295D	probably damaging	Het
Olfr1408	T	C	1: 173,130,917	Q100R	possibly damaging	Het
Olfr543	T	C	7: 102,477,502	M123V	probably damaging	Het
Olfr702	A	T	7: 106,823,662	I288N	probably damaging	Het
Parp9	C	A	16: 35,971,832		probably null	Het
Pax4	T	C	6: 28,446,279	I72V	probably benign	Het
Pcdh7	A	G	5: 57,721,748	I542V	probably benign	Het
Pcdhgb7	C	T	18: 37,752,886	R370W	probably damaging	Het
Pik3r1	G	A	13: 101,692,236	T18I	probably benign	Het
Ppara	A	G	15: 85,777,761	I68V	probably benign	Het
Ptch2	T	A	4: 117,105,949	I211N	probably damaging	Het
Senp6	G	A	9: 80,130,746	V715M	probably damaging	Het
Serf2	C	T	2: 121,450,703	P41L	possibly damaging	Het
Serpina12	T	C	12: 104,037,750	I208V	possibly damaging	Het
Serpinf2	T	C	11: 75,432,500	D460G	probably benign	Het
Sh3d21	T	C	4: 126,151,872	E338G	probably damaging	Het
Slc7a11	T	C	3: 50,379,150	D384G	probably damaging	Het
Snx15	A	G	19: 6,124,151		probably null	Het
Supt16	A	G	14: 52,183,092	F84L	probably damaging	Het
Tm9sf2	C	A	14: 122,143,501	Q169K	probably benign	Het
Trim56	A	T	5: 137,113,978	V228E	probably benign	Het
Triqk	T	A	4: 12,980,390		probably null	Het
Ttc21a	T	A	9: 119,966,565	I1155N	possibly damaging	Het
Ube3b	T	G	5: 114,419,631	Y1059D	probably damaging	Het
Vmn2r14	T	C	5: 109,216,095	T652A	probably benign	Het
Wdr4	A	G	17: 31,499,824	V304A	probably benign	Het
Wwp2	T	C	8: 107,554,062	S646P	possibly damaging	Het
Zfand5	T	A	19: 21,279,645	S130T	probably benign	Het
Zfp599	A	T	9: 22,250,100	Y256*	probably null	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het
Zfyve16	T	A	13: 92,505,689	I1209L	possibly damaging	Het

Other mutations in Hsp90aa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02056:Hsp90aa1	APN	12	110694015	unclassified	probably benign
IGL02243:Hsp90aa1	APN	12	110695091	missense	probably damaging	1.00
IGL02865:Hsp90aa1	APN	12	110693082	missense	probably benign	0.11
IGL02965:Hsp90aa1	APN	12	110695679	start codon destroyed	probably null	0.95
R0827:Hsp90aa1	UTSW	12	110692695	missense	probably benign	0.38
R1331:Hsp90aa1	UTSW	12	110692820	missense	probably damaging	1.00
R1498:Hsp90aa1	UTSW	12	110695688	splice site	probably null
R2039:Hsp90aa1	UTSW	12	110693782	missense	probably damaging	1.00
R2082:Hsp90aa1	UTSW	12	110692827	missense	probably damaging	1.00
R2102:Hsp90aa1	UTSW	12	110694132	missense	probably damaging	0.99
R2169:Hsp90aa1	UTSW	12	110692734	missense	probably damaging	0.99
R2194:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2194:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R2359:Hsp90aa1	UTSW	12	110694569	critical splice donor site	probably null
R2364:Hsp90aa1	UTSW	12	110692753	missense	probably damaging	0.99
R2393:Hsp90aa1	UTSW	12	110693406	missense	probably damaging	1.00
R2398:Hsp90aa1	UTSW	12	110692321	missense	possibly damaging	0.86
R2435:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2435:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R2924:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2924:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R2925:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2925:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3176:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3176:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3177:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3177:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3276:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3276:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3277:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3277:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3615:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3615:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3616:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3616:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R4033:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R4033:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R4815:Hsp90aa1	UTSW	12	110695226	missense	possibly damaging	0.45
R4932:Hsp90aa1	UTSW	12	110693717	missense	probably damaging	1.00
R5555:Hsp90aa1	UTSW	12	110692734	missense	probably damaging	1.00
R6382:Hsp90aa1	UTSW	12	110695517	critical splice donor site	probably null
R7024:Hsp90aa1	UTSW	12	110694112	missense	possibly damaging	0.46
R7324:Hsp90aa1	UTSW	12	110695225	missense	unknown
R7447:Hsp90aa1	UTSW	12	110692128	missense	possibly damaging	0.94
R7526:Hsp90aa1	UTSW	12	110695294	missense	unknown
R7732:Hsp90aa1	UTSW	12	110693418	missense	probably damaging	1.00
R8155:Hsp90aa1	UTSW	12	110695394	missense	unknown
R9004:Hsp90aa1	UTSW	12	110692611	missense	probably damaging	0.99
R9145:Hsp90aa1	UTSW	12	110696250	critical splice donor site	probably null
Z1177:Hsp90aa1	UTSW	12	110693466	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGCATACTGCTCATCGTC -3'
(R):5'- ATTGGACGTTGCTTTCCCTG -3'

Sequencing Primer
(F):5'- CGTTATGCTTCGTGATGACAGTCAC -3'
(R):5'- CCTGAAAATTTCACCTTGGGG -3'

Posted On

2016-06-15