Incidental Mutation 'R5117:Hsp90aa1'
ID 392700
Institutional Source Beutler Lab
Gene Symbol Hsp90aa1
Ensembl Gene ENSMUSG00000021270
Gene Name heat shock protein 90, alpha (cytosolic), class A member 1
Synonyms Hspca, Hsp86-1, Hsp89, hsp4, Hsp90
MMRRC Submission 042705-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5117 (G1)
Quality Score 168
Status Validated
Chromosome 12
Chromosomal Location 110657470-110662829 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 110661698 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 106 (N106S)
Ref Sequence ENSEMBL: ENSMUSP00000118189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021698] [ENSMUST00000094361] [ENSMUST00000124156] [ENSMUST00000149189] [ENSMUST00000155242]
AlphaFold P07901
Predicted Effect unknown
Transcript: ENSMUST00000021698
AA Change: N106S
SMART Domains Protein: ENSMUSP00000021698
Gene: ENSMUSG00000021270
AA Change: N106S

DomainStartEndE-ValueType
HATPase_c 40 194 2.94e-11 SMART
Pfam:HSP90 196 733 6.7e-272 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000094361
AA Change: N106S
SMART Domains Protein: ENSMUSP00000091921
Gene: ENSMUSG00000021270
AA Change: N106S

DomainStartEndE-ValueType
HATPase_c 40 194 2.94e-11 SMART
Pfam:HSP90 196 728 2e-245 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124156
SMART Domains Protein: ENSMUSP00000121138
Gene: ENSMUSG00000021270

DomainStartEndE-ValueType
PDB:3HHU|B 1 103 1e-69 PDB
SCOP:d1byqa_ 11 103 5e-48 SMART
Blast:HATPase_c 40 103 7e-39 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145255
Predicted Effect probably benign
Transcript: ENSMUST00000149189
SMART Domains Protein: ENSMUSP00000114201
Gene: ENSMUSG00000021270

DomainStartEndE-ValueType
PDB:3HHU|B 1 98 6e-66 PDB
SCOP:d1byqa_ 11 98 2e-45 SMART
Blast:HATPase_c 40 98 2e-35 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000155242
AA Change: N106S

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118189
Gene: ENSMUSG00000021270
AA Change: N106S

DomainStartEndE-ValueType
HATPase_c 40 194 2.94e-11 SMART
Meta Mutation Damage Score 0.3902 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inducible molecular chaperone that functions as a homodimer. The encoded protein aids in the proper folding of specific target proteins by use of an ATPase activity that is modulated by co-chaperones. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit male sterility associated with arrested male meiosis and male germ cell apoptosis. Mice homozygous for a transgenic gene disruption exhibit male sterility and small testis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik G A 9: 124,055,715 (GRCm39) T403I probably benign Het
4921509C19Rik T C 2: 151,314,460 (GRCm39) E406G probably benign Het
Abca8b T C 11: 109,857,629 (GRCm39) E641G probably damaging Het
Agrn T C 4: 156,270,010 (GRCm39) N49S probably benign Het
Cacna1b A G 2: 24,622,340 (GRCm39) S215P probably damaging Het
Cacna1g T A 11: 94,323,329 (GRCm39) I1292F probably damaging Het
Card14 T A 11: 119,229,076 (GRCm39) I662N probably damaging Het
Cep135 A G 5: 76,779,276 (GRCm39) K762R probably benign Het
Ces1b A G 8: 93,799,837 (GRCm39) probably null Het
Erich6 T G 3: 58,530,626 (GRCm39) I448L probably benign Het
Fads3 T G 19: 10,019,322 (GRCm39) probably null Het
Fam234a A G 17: 26,432,512 (GRCm39) F546L probably benign Het
Fbxl9 T A 8: 106,039,492 (GRCm39) R595* probably null Het
Gm10717 T C 9: 3,025,625 (GRCm39) L70S probably benign Het
Gm11787 G T 4: 3,509,524 (GRCm39) noncoding transcript Het
Gm5519 A G 19: 33,802,471 (GRCm39) *171W probably null Het
Grid2 T C 6: 63,233,917 (GRCm39) I26T probably benign Het
Hmcn2 T G 2: 31,348,061 (GRCm39) C4902W possibly damaging Het
Il18 A T 9: 50,492,809 (GRCm39) N125I possibly damaging Het
Ints9 G T 14: 65,230,540 (GRCm39) E156* probably null Het
Kalrn T C 16: 33,853,971 (GRCm39) probably null Het
Klkb1 A T 8: 45,742,149 (GRCm39) D43E possibly damaging Het
Lipo3 A T 19: 33,536,952 (GRCm39) M256K probably benign Het
Mapk6 C A 9: 75,305,017 (GRCm39) M133I possibly damaging Het
Med21 T A 6: 146,548,781 (GRCm39) probably benign Het
Myrf T A 19: 10,189,857 (GRCm39) E984V probably damaging Het
Naga A C 15: 82,221,657 (GRCm39) M28R probably damaging Het
Nphp4 T G 4: 152,608,689 (GRCm39) probably null Het
Nr1h4 T C 10: 89,314,284 (GRCm39) N295D probably damaging Het
Or10j27 T C 1: 172,958,484 (GRCm39) Q100R possibly damaging Het
Or13n4 A T 7: 106,422,869 (GRCm39) I288N probably damaging Het
Or55b3 T C 7: 102,126,709 (GRCm39) M123V probably damaging Het
Parp9 C A 16: 35,792,202 (GRCm39) probably null Het
Pax4 T C 6: 28,446,278 (GRCm39) I72V probably benign Het
Pcdh7 A G 5: 57,879,090 (GRCm39) I542V probably benign Het
Pcdhgb7 C T 18: 37,885,939 (GRCm39) R370W probably damaging Het
Pik3r1 G A 13: 101,828,744 (GRCm39) T18I probably benign Het
Ppara A G 15: 85,661,962 (GRCm39) I68V probably benign Het
Ptch2 T A 4: 116,963,146 (GRCm39) I211N probably damaging Het
Senp6 G A 9: 80,038,028 (GRCm39) V715M probably damaging Het
Serf2 C T 2: 121,281,184 (GRCm39) P41L possibly damaging Het
Serpina12 T C 12: 104,004,009 (GRCm39) I208V possibly damaging Het
Serpinf2 T C 11: 75,323,326 (GRCm39) D460G probably benign Het
Sh3d21 T C 4: 126,045,665 (GRCm39) E338G probably damaging Het
Slc7a11 T C 3: 50,333,599 (GRCm39) D384G probably damaging Het
Snx15 A G 19: 6,174,181 (GRCm39) probably null Het
Supt16 A G 14: 52,420,549 (GRCm39) F84L probably damaging Het
Tamalin A G 15: 101,128,418 (GRCm39) D152G probably damaging Het
Thoc2l A G 5: 104,668,121 (GRCm39) Y881C probably damaging Het
Tm9sf2 C A 14: 122,380,913 (GRCm39) Q169K probably benign Het
Trim56 A T 5: 137,142,832 (GRCm39) V228E probably benign Het
Triqk T A 4: 12,980,390 (GRCm39) probably null Het
Ttc21a T A 9: 119,795,631 (GRCm39) I1155N possibly damaging Het
Ube3b T G 5: 114,557,692 (GRCm39) Y1059D probably damaging Het
Vmn2r14 T C 5: 109,363,961 (GRCm39) T652A probably benign Het
Wdr4 A G 17: 31,718,798 (GRCm39) V304A probably benign Het
Wwp2 T C 8: 108,280,694 (GRCm39) S646P possibly damaging Het
Zfand5 T A 19: 21,257,009 (GRCm39) S130T probably benign Het
Zfp599 A T 9: 22,161,396 (GRCm39) Y256* probably null Het
Zfp703 C T 8: 27,469,233 (GRCm39) P299L probably damaging Het
Zfyve16 T A 13: 92,642,197 (GRCm39) I1209L possibly damaging Het
Other mutations in Hsp90aa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02056:Hsp90aa1 APN 12 110,660,449 (GRCm39) unclassified probably benign
IGL02243:Hsp90aa1 APN 12 110,661,525 (GRCm39) missense probably damaging 1.00
IGL02865:Hsp90aa1 APN 12 110,659,516 (GRCm39) missense probably benign 0.11
IGL02965:Hsp90aa1 APN 12 110,662,113 (GRCm39) start codon destroyed probably null 0.95
R0827:Hsp90aa1 UTSW 12 110,659,129 (GRCm39) missense probably benign 0.38
R1331:Hsp90aa1 UTSW 12 110,659,254 (GRCm39) missense probably damaging 1.00
R1498:Hsp90aa1 UTSW 12 110,662,122 (GRCm39) splice site probably null
R2039:Hsp90aa1 UTSW 12 110,660,216 (GRCm39) missense probably damaging 1.00
R2082:Hsp90aa1 UTSW 12 110,659,261 (GRCm39) missense probably damaging 1.00
R2102:Hsp90aa1 UTSW 12 110,660,566 (GRCm39) missense probably damaging 0.99
R2169:Hsp90aa1 UTSW 12 110,659,168 (GRCm39) missense probably damaging 0.99
R2194:Hsp90aa1 UTSW 12 110,662,115 (GRCm39) critical splice acceptor site probably null
R2194:Hsp90aa1 UTSW 12 110,662,114 (GRCm39) start codon destroyed possibly damaging 0.59
R2359:Hsp90aa1 UTSW 12 110,661,003 (GRCm39) critical splice donor site probably null
R2364:Hsp90aa1 UTSW 12 110,659,187 (GRCm39) missense probably damaging 0.99
R2393:Hsp90aa1 UTSW 12 110,659,840 (GRCm39) missense probably damaging 1.00
R2398:Hsp90aa1 UTSW 12 110,658,755 (GRCm39) missense possibly damaging 0.86
R2435:Hsp90aa1 UTSW 12 110,662,115 (GRCm39) critical splice acceptor site probably null
R2435:Hsp90aa1 UTSW 12 110,662,114 (GRCm39) start codon destroyed possibly damaging 0.59
R2924:Hsp90aa1 UTSW 12 110,662,115 (GRCm39) critical splice acceptor site probably null
R2924:Hsp90aa1 UTSW 12 110,662,114 (GRCm39) start codon destroyed possibly damaging 0.59
R2925:Hsp90aa1 UTSW 12 110,662,115 (GRCm39) critical splice acceptor site probably null
R2925:Hsp90aa1 UTSW 12 110,662,114 (GRCm39) start codon destroyed possibly damaging 0.59
R3176:Hsp90aa1 UTSW 12 110,662,115 (GRCm39) critical splice acceptor site probably null
R3176:Hsp90aa1 UTSW 12 110,662,114 (GRCm39) start codon destroyed possibly damaging 0.59
R3177:Hsp90aa1 UTSW 12 110,662,115 (GRCm39) critical splice acceptor site probably null
R3177:Hsp90aa1 UTSW 12 110,662,114 (GRCm39) start codon destroyed possibly damaging 0.59
R3276:Hsp90aa1 UTSW 12 110,662,115 (GRCm39) critical splice acceptor site probably null
R3276:Hsp90aa1 UTSW 12 110,662,114 (GRCm39) start codon destroyed possibly damaging 0.59
R3277:Hsp90aa1 UTSW 12 110,662,115 (GRCm39) critical splice acceptor site probably null
R3277:Hsp90aa1 UTSW 12 110,662,114 (GRCm39) start codon destroyed possibly damaging 0.59
R3615:Hsp90aa1 UTSW 12 110,662,115 (GRCm39) critical splice acceptor site probably null
R3615:Hsp90aa1 UTSW 12 110,662,114 (GRCm39) start codon destroyed possibly damaging 0.59
R3616:Hsp90aa1 UTSW 12 110,662,115 (GRCm39) critical splice acceptor site probably null
R3616:Hsp90aa1 UTSW 12 110,662,114 (GRCm39) start codon destroyed possibly damaging 0.59
R4033:Hsp90aa1 UTSW 12 110,662,114 (GRCm39) start codon destroyed possibly damaging 0.59
R4033:Hsp90aa1 UTSW 12 110,662,115 (GRCm39) critical splice acceptor site probably null
R4815:Hsp90aa1 UTSW 12 110,661,660 (GRCm39) missense possibly damaging 0.45
R4932:Hsp90aa1 UTSW 12 110,660,151 (GRCm39) missense probably damaging 1.00
R5555:Hsp90aa1 UTSW 12 110,659,168 (GRCm39) missense probably damaging 1.00
R6382:Hsp90aa1 UTSW 12 110,661,951 (GRCm39) critical splice donor site probably null
R7024:Hsp90aa1 UTSW 12 110,660,546 (GRCm39) missense possibly damaging 0.46
R7324:Hsp90aa1 UTSW 12 110,661,659 (GRCm39) missense unknown
R7447:Hsp90aa1 UTSW 12 110,658,562 (GRCm39) missense possibly damaging 0.94
R7526:Hsp90aa1 UTSW 12 110,661,728 (GRCm39) missense unknown
R7732:Hsp90aa1 UTSW 12 110,659,852 (GRCm39) missense probably damaging 1.00
R8155:Hsp90aa1 UTSW 12 110,661,828 (GRCm39) missense unknown
R9004:Hsp90aa1 UTSW 12 110,659,045 (GRCm39) missense probably damaging 0.99
R9145:Hsp90aa1 UTSW 12 110,662,684 (GRCm39) critical splice donor site probably null
Z1177:Hsp90aa1 UTSW 12 110,659,900 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCATACTGCTCATCGTC -3'
(R):5'- ATTGGACGTTGCTTTCCCTG -3'

Sequencing Primer
(F):5'- CGTTATGCTTCGTGATGACAGTCAC -3'
(R):5'- CCTGAAAATTTCACCTTGGGG -3'
Posted On 2016-06-15