Incidental Mutation 'R5117:Tm9sf2'
ID 392705
Institutional Source Beutler Lab
Gene Symbol Tm9sf2
Ensembl Gene ENSMUSG00000025544
Gene Name transmembrane 9 superfamily member 2
Synonyms D14Ertd64e, P76, 1500001N15Rik
MMRRC Submission 042705-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.896) question?
Stock # R5117 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 122107038-122159604 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 122143501 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 169 (Q169K)
Ref Sequence ENSEMBL: ENSMUSP00000131227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026624] [ENSMUST00000171318]
AlphaFold P58021
Predicted Effect probably benign
Transcript: ENSMUST00000026624
AA Change: Q334K

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000026624
Gene: ENSMUSG00000025544
AA Change: Q334K

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:EMP70 74 619 4.5e-209 PFAM
transmembrane domain 630 652 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171318
AA Change: Q169K

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000131227
Gene: ENSMUSG00000025544
AA Change: Q169K

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:EMP70 73 112 5.9e-9 PFAM
Pfam:EMP70 109 455 1e-172 PFAM
transmembrane domain 465 487 N/A INTRINSIC
Meta Mutation Damage Score 0.0843 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transmembrane 9 superfamily. The encoded 76 kDa protein localizes to early endosomes in human cells. The encoded protein possesses a conserved and highly hydrophobic C-terminal domain which contains nine transmembrane domains. The protein may play a role in small molecule transport or act as an ion channel. A pseudogene associated with this gene is located on the X chromosome. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik G A 9: 124,293,085 T403I probably benign Het
4921509C19Rik T C 2: 151,472,540 E406G probably benign Het
Abca8b T C 11: 109,966,803 E641G probably damaging Het
Agrn T C 4: 156,185,553 N49S probably benign Het
BC005561 A G 5: 104,520,255 Y881C probably damaging Het
Cacna1b A G 2: 24,732,328 S215P probably damaging Het
Cacna1g T A 11: 94,432,503 I1292F probably damaging Het
Card14 T A 11: 119,338,250 I662N probably damaging Het
Cep135 A G 5: 76,631,429 K762R probably benign Het
Ces1b A G 8: 93,073,209 probably null Het
Erich6 T G 3: 58,623,205 I448L probably benign Het
Fads3 T G 19: 10,041,958 probably null Het
Fam234a A G 17: 26,213,538 F546L probably benign Het
Gm10717 T C 9: 3,025,625 L70S probably benign Het
Gm11787 G T 4: 3,509,524 noncoding transcript Het
Gm5519 A G 19: 33,825,071 *171W probably null Het
Grasp A G 15: 101,230,537 D152G probably damaging Het
Grid2 T C 6: 63,256,933 I26T probably benign Het
Hmcn2 T G 2: 31,458,049 C4902W possibly damaging Het
Hsp90aa1 T C 12: 110,695,264 N106S possibly damaging Het
Il18 A T 9: 50,581,509 N125I possibly damaging Het
Ints9 G T 14: 64,993,091 E156* probably null Het
Kalrn T C 16: 34,033,601 probably null Het
Klkb1 A T 8: 45,289,112 D43E possibly damaging Het
Lipo3 A T 19: 33,559,552 M256K probably benign Het
Lrrc29 T A 8: 105,312,860 R595* probably null Het
Mapk6 C A 9: 75,397,735 M133I possibly damaging Het
Med21 T A 6: 146,647,283 probably benign Het
Myrf T A 19: 10,212,493 E984V probably damaging Het
Naga A C 15: 82,337,456 M28R probably damaging Het
Nphp4 T G 4: 152,524,232 probably null Het
Nr1h4 T C 10: 89,478,422 N295D probably damaging Het
Olfr1408 T C 1: 173,130,917 Q100R possibly damaging Het
Olfr543 T C 7: 102,477,502 M123V probably damaging Het
Olfr702 A T 7: 106,823,662 I288N probably damaging Het
Parp9 C A 16: 35,971,832 probably null Het
Pax4 T C 6: 28,446,279 I72V probably benign Het
Pcdh7 A G 5: 57,721,748 I542V probably benign Het
Pcdhgb7 C T 18: 37,752,886 R370W probably damaging Het
Pik3r1 G A 13: 101,692,236 T18I probably benign Het
Ppara A G 15: 85,777,761 I68V probably benign Het
Ptch2 T A 4: 117,105,949 I211N probably damaging Het
Senp6 G A 9: 80,130,746 V715M probably damaging Het
Serf2 C T 2: 121,450,703 P41L possibly damaging Het
Serpina12 T C 12: 104,037,750 I208V possibly damaging Het
Serpinf2 T C 11: 75,432,500 D460G probably benign Het
Sh3d21 T C 4: 126,151,872 E338G probably damaging Het
Slc7a11 T C 3: 50,379,150 D384G probably damaging Het
Snx15 A G 19: 6,124,151 probably null Het
Supt16 A G 14: 52,183,092 F84L probably damaging Het
Trim56 A T 5: 137,113,978 V228E probably benign Het
Triqk T A 4: 12,980,390 probably null Het
Ttc21a T A 9: 119,966,565 I1155N possibly damaging Het
Ube3b T G 5: 114,419,631 Y1059D probably damaging Het
Vmn2r14 T C 5: 109,216,095 T652A probably benign Het
Wdr4 A G 17: 31,499,824 V304A probably benign Het
Wwp2 T C 8: 107,554,062 S646P possibly damaging Het
Zfand5 T A 19: 21,279,645 S130T probably benign Het
Zfp599 A T 9: 22,250,100 Y256* probably null Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfyve16 T A 13: 92,505,689 I1209L possibly damaging Het
Other mutations in Tm9sf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Tm9sf2 APN 14 122143460 missense probably damaging 1.00
IGL01995:Tm9sf2 APN 14 122143471 missense probably benign 0.25
IGL02173:Tm9sf2 APN 14 122143423 missense probably benign 0.13
IGL02249:Tm9sf2 APN 14 122123750 missense probably damaging 1.00
IGL02328:Tm9sf2 APN 14 122143430 missense possibly damaging 0.79
IGL03231:Tm9sf2 APN 14 122141252 missense possibly damaging 0.95
R0367:Tm9sf2 UTSW 14 122155368 missense probably benign 0.06
R1959:Tm9sf2 UTSW 14 122126164 missense probably benign 0.42
R2251:Tm9sf2 UTSW 14 122139731 missense probably benign
R2504:Tm9sf2 UTSW 14 122158684 missense probably benign 0.01
R4791:Tm9sf2 UTSW 14 122139650 missense probably benign 0.00
R4795:Tm9sf2 UTSW 14 122149840 splice site probably null
R4851:Tm9sf2 UTSW 14 122141204 missense probably benign 0.00
R5063:Tm9sf2 UTSW 14 122145146 missense probably damaging 1.00
R5443:Tm9sf2 UTSW 14 122126195 missense probably damaging 0.97
R5677:Tm9sf2 UTSW 14 122151962 critical splice acceptor site probably null
R5966:Tm9sf2 UTSW 14 122137509 intron probably benign
R6465:Tm9sf2 UTSW 14 122141207 missense probably benign 0.16
R6873:Tm9sf2 UTSW 14 122145113 missense probably damaging 1.00
R7403:Tm9sf2 UTSW 14 122141228 missense probably benign 0.33
R7531:Tm9sf2 UTSW 14 122142412 missense possibly damaging 0.49
R8176:Tm9sf2 UTSW 14 122137501 missense probably benign 0.01
R8447:Tm9sf2 UTSW 14 122139768 missense probably damaging 1.00
R8773:Tm9sf2 UTSW 14 122143471 missense probably benign 0.21
R9039:Tm9sf2 UTSW 14 122126164 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- ACTAGTGTTCCTGAGTGCCG -3'
(R):5'- TAGATCAATTTGGGGCCAAGTGG -3'

Sequencing Primer
(F):5'- ATGGCCCCGATTGAGCTG -3'
(R):5'- GCCAAGTGGTTTTGTTCATGAC -3'
Posted On 2016-06-15