Incidental Mutation 'R5117:Naga'
ID392706
Institutional Source Beutler Lab
Gene Symbol Naga
Ensembl Gene ENSMUSG00000022453
Gene NameN-acetyl galactosaminidase, alpha
Synonyms
MMRRC Submission 042705-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5117 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location82329532-82338925 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 82337456 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 28 (M28R)
Ref Sequence ENSEMBL: ENSMUSP00000155062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023088] [ENSMUST00000050349] [ENSMUST00000160994] [ENSMUST00000161178] [ENSMUST00000229294] [ENSMUST00000229388] [ENSMUST00000229733] [ENSMUST00000229948] [ENSMUST00000230269] [ENSMUST00000230380]
Predicted Effect probably damaging
Transcript: ENSMUST00000023088
AA Change: M28R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023088
Gene: ENSMUSG00000022453
AA Change: M28R

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Melibiase_2 25 394 2.1e-171 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050349
SMART Domains Protein: ENSMUSP00000060598
Gene: ENSMUSG00000049687

DomainStartEndE-ValueType
PH 18 123 1.02e-10 SMART
coiled coil region 128 150 N/A INTRINSIC
Blast:PH 192 242 1e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159942
Predicted Effect probably benign
Transcript: ENSMUST00000160994
Predicted Effect probably benign
Transcript: ENSMUST00000161178
SMART Domains Protein: ENSMUSP00000124703
Gene: ENSMUSG00000049687

DomainStartEndE-ValueType
PH 18 123 1.02e-10 SMART
coiled coil region 128 150 N/A INTRINSIC
Blast:PH 192 242 1e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162705
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162983
Predicted Effect probably damaging
Transcript: ENSMUST00000229294
AA Change: M12R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000229388
AA Change: M28R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000229733
Predicted Effect unknown
Transcript: ENSMUST00000229948
AA Change: M28R
Predicted Effect probably benign
Transcript: ENSMUST00000230139
Predicted Effect probably damaging
Transcript: ENSMUST00000230269
AA Change: M12R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000230380
AA Change: M28R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230664
Meta Mutation Damage Score 0.9698 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NAGA encodes the lysosomal enzyme alpha-N-acetylgalactosaminidase, which cleaves alpha-N-acetylgalactosaminyl moieties from glycoconjugates. Mutations in NAGA have been identified as the cause of Schindler disease types I and II (type II also known as Kanzaki disease). [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik G A 9: 124,293,085 T403I probably benign Het
4921509C19Rik T C 2: 151,472,540 E406G probably benign Het
Abca8b T C 11: 109,966,803 E641G probably damaging Het
Agrn T C 4: 156,185,553 N49S probably benign Het
BC005561 A G 5: 104,520,255 Y881C probably damaging Het
Cacna1b A G 2: 24,732,328 S215P probably damaging Het
Cacna1g T A 11: 94,432,503 I1292F probably damaging Het
Card14 T A 11: 119,338,250 I662N probably damaging Het
Cep135 A G 5: 76,631,429 K762R probably benign Het
Ces1b A G 8: 93,073,209 probably null Het
Erich6 T G 3: 58,623,205 I448L probably benign Het
Fads3 T G 19: 10,041,958 probably null Het
Fam234a A G 17: 26,213,538 F546L probably benign Het
Gm10717 T C 9: 3,025,625 L70S probably benign Het
Gm11787 G T 4: 3,509,524 noncoding transcript Het
Gm5519 A G 19: 33,825,071 *171W probably null Het
Grasp A G 15: 101,230,537 D152G probably damaging Het
Grid2 T C 6: 63,256,933 I26T probably benign Het
Hmcn2 T G 2: 31,458,049 C4902W possibly damaging Het
Hsp90aa1 T C 12: 110,695,264 N106S possibly damaging Het
Il18 A T 9: 50,581,509 N125I possibly damaging Het
Ints9 G T 14: 64,993,091 E156* probably null Het
Kalrn T C 16: 34,033,601 probably null Het
Klkb1 A T 8: 45,289,112 D43E possibly damaging Het
Lipo3 A T 19: 33,559,552 M256K probably benign Het
Lrrc29 T A 8: 105,312,860 R595* probably null Het
Mapk6 C A 9: 75,397,735 M133I possibly damaging Het
Med21 T A 6: 146,647,283 probably benign Het
Myrf T A 19: 10,212,493 E984V probably damaging Het
Nphp4 T G 4: 152,524,232 probably null Het
Nr1h4 T C 10: 89,478,422 N295D probably damaging Het
Olfr1408 T C 1: 173,130,917 Q100R possibly damaging Het
Olfr543 T C 7: 102,477,502 M123V probably damaging Het
Olfr702 A T 7: 106,823,662 I288N probably damaging Het
Parp9 C A 16: 35,971,832 probably null Het
Pax4 T C 6: 28,446,279 I72V probably benign Het
Pcdh7 A G 5: 57,721,748 I542V probably benign Het
Pcdhgb7 C T 18: 37,752,886 R370W probably damaging Het
Pik3r1 G A 13: 101,692,236 T18I probably benign Het
Ppara A G 15: 85,777,761 I68V probably benign Het
Ptch2 T A 4: 117,105,949 I211N probably damaging Het
Senp6 G A 9: 80,130,746 V715M probably damaging Het
Serf2 C T 2: 121,450,703 P41L possibly damaging Het
Serpina12 T C 12: 104,037,750 I208V possibly damaging Het
Serpinf2 T C 11: 75,432,500 D460G probably benign Het
Sh3d21 T C 4: 126,151,872 E338G probably damaging Het
Slc7a11 T C 3: 50,379,150 D384G probably damaging Het
Snx15 A G 19: 6,124,151 probably null Het
Supt16 A G 14: 52,183,092 F84L probably damaging Het
Tm9sf2 C A 14: 122,143,501 Q169K probably benign Het
Trim56 A T 5: 137,113,978 V228E probably benign Het
Triqk T A 4: 12,980,390 probably null Het
Ttc21a T A 9: 119,966,565 I1155N possibly damaging Het
Ube3b T G 5: 114,419,631 Y1059D probably damaging Het
Vmn2r14 T C 5: 109,216,095 T652A probably benign Het
Wdr4 A G 17: 31,499,824 V304A probably benign Het
Wwp2 T C 8: 107,554,062 S646P possibly damaging Het
Zfand5 T A 19: 21,279,645 S130T probably benign Het
Zfp599 A T 9: 22,250,100 Y256* probably null Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfyve16 T A 13: 92,505,689 I1209L possibly damaging Het
Other mutations in Naga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01148:Naga APN 15 82330660 missense possibly damaging 0.50
IGL01515:Naga APN 15 82330159 missense probably benign 0.06
IGL02556:Naga APN 15 82330136 missense probably damaging 1.00
IGL02934:Naga APN 15 82330200 missense possibly damaging 0.46
IGL03135:Naga APN 15 82330741 missense probably damaging 1.00
IGL03308:Naga APN 15 82335887 missense probably damaging 1.00
Gui_lin UTSW 15 82336894 nonsense probably null
R0485:Naga UTSW 15 82336755 splice site probably benign
R1179:Naga UTSW 15 82330156 missense probably benign 0.31
R1466:Naga UTSW 15 82334788 missense probably null 0.86
R1466:Naga UTSW 15 82334788 missense probably null 0.86
R1584:Naga UTSW 15 82334788 missense probably null 0.86
R1802:Naga UTSW 15 82337468 missense probably benign 0.39
R2520:Naga UTSW 15 82330094 missense probably benign 0.00
R4306:Naga UTSW 15 82336894 nonsense probably null
R4493:Naga UTSW 15 82332514 missense probably damaging 1.00
R5738:Naga UTSW 15 82334853 nonsense probably null
R6080:Naga UTSW 15 82334847 missense probably benign 0.02
R6290:Naga UTSW 15 82334856 missense possibly damaging 0.94
R6320:Naga UTSW 15 82332203 splice site probably null
R6658:Naga UTSW 15 82330774 missense probably benign 0.02
R7597:Naga UTSW 15 82334834 missense probably benign 0.06
R7727:Naga UTSW 15 82330147 missense probably benign 0.01
Z1177:Naga UTSW 15 82336814 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGGCTAGGTGTCAGATACATTC -3'
(R):5'- TAACCCTACTGGCCTGTACC -3'

Sequencing Primer
(F):5'- GCTAGGTGTCAGATACATTCATTCTG -3'
(R):5'- TACTGGCCTGTACCTGGGGAG -3'
Posted On2016-06-15