Incidental Mutation 'R5117:Grasp'
ID392708
Institutional Source Beutler Lab
Gene Symbol Grasp
Ensembl Gene ENSMUSG00000000531
Gene NameGRP1 (general receptor for phosphoinositides 1)-associated scaffold protein
Synonymstamalin
MMRRC Submission 042705-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R5117 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location101224188-101232756 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101230537 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 152 (D152G)
Ref Sequence ENSEMBL: ENSMUSP00000000543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000543]
Predicted Effect probably damaging
Transcript: ENSMUST00000000543
AA Change: D152G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000543
Gene: ENSMUSG00000000531
AA Change: D152G

DomainStartEndE-ValueType
low complexity region 30 57 N/A INTRINSIC
PDZ 109 189 2.12e-13 SMART
low complexity region 248 277 N/A INTRINSIC
low complexity region 291 312 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
Meta Mutation Damage Score 0.9524 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a molecular scaffold, linking receptors, including group 1 metabotropic glutamate receptors, to neuronal proteins. The encoded protein contains conserved domains, including a leucine zipper sequence, PDZ domain and a C-terminal PDZ-binding motif. Alternately spliced transcript variants have been observed for this gene.[provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for targeted null mutations develop and behave normally under ordinary conditions but display a marked reduction in sensitivity to acute morphine responses and impaired adaptive responses to morphine and cocaine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik G A 9: 124,293,085 T403I probably benign Het
4921509C19Rik T C 2: 151,472,540 E406G probably benign Het
Abca8b T C 11: 109,966,803 E641G probably damaging Het
Agrn T C 4: 156,185,553 N49S probably benign Het
BC005561 A G 5: 104,520,255 Y881C probably damaging Het
Cacna1b A G 2: 24,732,328 S215P probably damaging Het
Cacna1g T A 11: 94,432,503 I1292F probably damaging Het
Card14 T A 11: 119,338,250 I662N probably damaging Het
Cep135 A G 5: 76,631,429 K762R probably benign Het
Ces1b A G 8: 93,073,209 probably null Het
Erich6 T G 3: 58,623,205 I448L probably benign Het
Fads3 T G 19: 10,041,958 probably null Het
Fam234a A G 17: 26,213,538 F546L probably benign Het
Gm10717 T C 9: 3,025,625 L70S probably benign Het
Gm11787 G T 4: 3,509,524 noncoding transcript Het
Gm5519 A G 19: 33,825,071 *171W probably null Het
Grid2 T C 6: 63,256,933 I26T probably benign Het
Hmcn2 T G 2: 31,458,049 C4902W possibly damaging Het
Hsp90aa1 T C 12: 110,695,264 N106S possibly damaging Het
Il18 A T 9: 50,581,509 N125I possibly damaging Het
Ints9 G T 14: 64,993,091 E156* probably null Het
Kalrn T C 16: 34,033,601 probably null Het
Klkb1 A T 8: 45,289,112 D43E possibly damaging Het
Lipo3 A T 19: 33,559,552 M256K probably benign Het
Lrrc29 T A 8: 105,312,860 R595* probably null Het
Mapk6 C A 9: 75,397,735 M133I possibly damaging Het
Med21 T A 6: 146,647,283 probably benign Het
Myrf T A 19: 10,212,493 E984V probably damaging Het
Naga A C 15: 82,337,456 M28R probably damaging Het
Nphp4 T G 4: 152,524,232 probably null Het
Nr1h4 T C 10: 89,478,422 N295D probably damaging Het
Olfr1408 T C 1: 173,130,917 Q100R possibly damaging Het
Olfr543 T C 7: 102,477,502 M123V probably damaging Het
Olfr702 A T 7: 106,823,662 I288N probably damaging Het
Parp9 C A 16: 35,971,832 probably null Het
Pax4 T C 6: 28,446,279 I72V probably benign Het
Pcdh7 A G 5: 57,721,748 I542V probably benign Het
Pcdhgb7 C T 18: 37,752,886 R370W probably damaging Het
Pik3r1 G A 13: 101,692,236 T18I probably benign Het
Ppara A G 15: 85,777,761 I68V probably benign Het
Ptch2 T A 4: 117,105,949 I211N probably damaging Het
Senp6 G A 9: 80,130,746 V715M probably damaging Het
Serf2 C T 2: 121,450,703 P41L possibly damaging Het
Serpina12 T C 12: 104,037,750 I208V possibly damaging Het
Serpinf2 T C 11: 75,432,500 D460G probably benign Het
Sh3d21 T C 4: 126,151,872 E338G probably damaging Het
Slc7a11 T C 3: 50,379,150 D384G probably damaging Het
Snx15 A G 19: 6,124,151 probably null Het
Supt16 A G 14: 52,183,092 F84L probably damaging Het
Tm9sf2 C A 14: 122,143,501 Q169K probably benign Het
Trim56 A T 5: 137,113,978 V228E probably benign Het
Triqk T A 4: 12,980,390 probably null Het
Ttc21a T A 9: 119,966,565 I1155N possibly damaging Het
Ube3b T G 5: 114,419,631 Y1059D probably damaging Het
Vmn2r14 T C 5: 109,216,095 T652A probably benign Het
Wdr4 A G 17: 31,499,824 V304A probably benign Het
Wwp2 T C 8: 107,554,062 S646P possibly damaging Het
Zfand5 T A 19: 21,279,645 S130T probably benign Het
Zfp599 A T 9: 22,250,100 Y256* probably null Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfyve16 T A 13: 92,505,689 I1209L possibly damaging Het
Other mutations in Grasp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Grasp APN 15 101228896 splice site probably benign
IGL02069:Grasp APN 15 101224465 missense probably damaging 1.00
IGL02516:Grasp APN 15 101229051 missense probably damaging 1.00
IGL02997:Grasp APN 15 101231018 missense probably damaging 1.00
IGL03079:Grasp APN 15 101230567 missense probably damaging 1.00
R0020:Grasp UTSW 15 101230552 missense probably damaging 1.00
R0020:Grasp UTSW 15 101230552 missense probably damaging 1.00
R1916:Grasp UTSW 15 101226969 splice site probably benign
R1952:Grasp UTSW 15 101224500 missense probably benign 0.07
R4247:Grasp UTSW 15 101224537 missense possibly damaging 0.55
R5040:Grasp UTSW 15 101229042 missense probably damaging 1.00
R7290:Grasp UTSW 15 101231538 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGGGAGAAATGGCTGTG -3'
(R):5'- TCCCGTACAGAGTTTCCAGC -3'

Sequencing Primer
(F):5'- GTAGTCCAGATTGGCGTCAAACTC -3'
(R):5'- TACAGAGTTTCCAGCCTGGG -3'
Posted On2016-06-15