Incidental Mutation 'R5118:Olfr1408'
ID392720
Institutional Source Beutler Lab
Gene Symbol Olfr1408
Ensembl Gene ENSMUSG00000062527
Gene Nameolfactory receptor 1408
SynonymsMOR267-4, GA_x6K02T2R7CC-715776-716708
MMRRC Submission 042706-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R5118 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location173128049-173137374 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 173130917 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 100 (Q100R)
Ref Sequence ENSEMBL: ENSMUSP00000073345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073663] [ENSMUST00000200689]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073663
AA Change: Q100R

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073345
Gene: ENSMUSG00000062527
AA Change: Q100R

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.5e-55 PFAM
Pfam:7tm_1 41 289 9.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200689
AA Change: Q100R

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143864
Gene: ENSMUSG00000062527
AA Change: Q100R

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.5e-55 PFAM
Pfam:7tm_1 41 289 9.4e-19 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Adamts2 A G 11: 50,781,869 E648G probably damaging Het
Ankrd55 A G 13: 112,355,939 S187G probably benign Het
BC080695 T C 4: 143,571,127 L39P probably damaging Het
C87414 T A 5: 93,637,797 D208V probably benign Het
Cd44 C A 2: 102,865,370 E52D probably damaging Het
Col6a5 T A 9: 105,937,005 I603F unknown Het
Dmxl2 C A 9: 54,460,987 R233L probably damaging Het
Dopey1 T C 9: 86,506,259 F429L probably damaging Het
Epsti1 T G 14: 77,986,682 probably null Het
Erfe G T 1: 91,370,716 probably null Het
Galnt5 A G 2: 58,015,003 D526G probably damaging Het
Gm1330 T C 2: 149,002,986 probably benign Het
Gm6181 G A 7: 52,755,616 noncoding transcript Het
Irak2 T A 6: 113,665,811 V68D probably benign Het
Kdm1a A G 4: 136,557,358 probably benign Het
Kidins220 C A 12: 24,992,297 Q198K probably damaging Het
Lgr5 A G 10: 115,452,339 V728A possibly damaging Het
Micall2 G A 5: 139,716,447 T347M probably damaging Het
Mrap2 T C 9: 87,182,703 F166L possibly damaging Het
Msh3 A T 13: 92,309,434 probably benign Het
Mul1 T A 4: 138,439,349 L238Q probably damaging Het
Nuak1 G T 10: 84,374,984 H413Q probably benign Het
Pcnt C T 10: 76,412,168 A931T probably damaging Het
Pddc1 A T 7: 141,406,806 probably benign Het
Psmb4 T C 3: 94,884,942 Y223C probably damaging Het
Rbm15b G T 9: 106,886,102 A289E possibly damaging Het
Reg3b T A 6: 78,372,128 V79E probably damaging Het
Rsl1 A G 13: 67,181,981 I164M probably damaging Het
Rtp1 T C 16: 23,431,535 F217L probably benign Het
Sfmbt1 T C 14: 30,790,770 L360P probably damaging Het
Sorbs2 T C 8: 45,795,785 V611A probably damaging Het
Tenm4 T A 7: 96,893,086 D1935E probably damaging Het
Tep1 T C 14: 50,855,587 probably null Het
Tmppe T G 9: 114,405,481 S283A probably benign Het
Tmtc1 A G 6: 148,269,987 probably benign Het
Trp63 T C 16: 25,889,010 I552T unknown Het
Tspan2 C A 3: 102,749,835 D45E probably benign Het
Ubr1 T C 2: 120,882,264 E1396G probably benign Het
Usp17lc A T 7: 103,418,661 T388S probably benign Het
Wdr46 T C 17: 33,948,837 V508A possibly damaging Het
Zcchc11 T A 4: 108,520,292 D966E possibly damaging Het
Zfp462 T A 4: 55,010,667 Y878N probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp954 T A 7: 7,115,715 T277S probably benign Het
Other mutations in Olfr1408
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Olfr1408 APN 1 173130411 nonsense probably null
IGL01371:Olfr1408 APN 1 173130531 missense possibly damaging 0.67
IGL01816:Olfr1408 APN 1 173130273 utr 3 prime probably benign
IGL02543:Olfr1408 APN 1 173130334 missense probably damaging 0.99
IGL03104:Olfr1408 APN 1 173130959 missense probably benign 0.00
IGL03183:Olfr1408 APN 1 173130858 missense probably damaging 0.97
R0940:Olfr1408 UTSW 1 173130453 missense probably benign 0.42
R1835:Olfr1408 UTSW 1 173130815 missense probably benign 0.00
R1993:Olfr1408 UTSW 1 173130851 missense possibly damaging 0.65
R1994:Olfr1408 UTSW 1 173130851 missense possibly damaging 0.65
R4438:Olfr1408 UTSW 1 173130302 missense probably benign 0.02
R4948:Olfr1408 UTSW 1 173130959 missense probably benign 0.00
R5088:Olfr1408 UTSW 1 173131039 missense probably damaging 1.00
R5117:Olfr1408 UTSW 1 173130917 missense possibly damaging 0.91
R5344:Olfr1408 UTSW 1 173131106 missense probably benign 0.16
R8176:Olfr1408 UTSW 1 173130816 missense probably benign 0.00
X0018:Olfr1408 UTSW 1 173130699 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATGGCAGCCTGAATATGGC -3'
(R):5'- ATATATCCTGACGCTGACTGGC -3'

Sequencing Primer
(F):5'- CAGCCTGAATATGGCCAGAGC -3'
(R):5'- ACGCTGACTGGCAATGTCATC -3'
Posted On2016-06-15