Mutagenetix > Incidental Mutations

Incidental Mutation 'R5118:Galnt5'

392721

Institutional Source

Beutler Lab

Gene Symbol

Galnt5

Ensembl Gene

ENSMUSG00000026828

Gene Name

polypeptide N-acetylgalactosaminyltransferase 5

Synonyms

ppGaNTase-T5

MMRRC Submission

042706-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5118 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

57997884-58045860 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 58015003 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 526 (D526G)

Ref Sequence

ENSEMBL: ENSMUSP00000131362 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112616] [ENSMUST00000166729]

AlphaFold

Q8C102

Predicted Effect

probably damaging
Transcript: ENSMUST00000112616
AA Change: D526G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108235
Gene: ENSMUSG00000026828
AA Change: D526G

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
low complexity region	319	330	N/A	INTRINSIC
Pfam:Glycos_transf_2	489	672	1.3e-33	PFAM
Pfam:Glyco_transf_7C	653	718	1.9e-8	PFAM
RICIN	801	925	1.36e-19	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144671

Predicted Effect

probably damaging
Transcript: ENSMUST00000166729
AA Change: D526G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131362
Gene: ENSMUSG00000026828
AA Change: D526G

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
low complexity region	319	330	N/A	INTRINSIC
Pfam:Glycos_transf_2	489	672	2.1e-30	PFAM
Pfam:Glyco_transf_7C	652	718	7e-8	PFAM
RICIN	801	925	1.36e-19	SMART

Meta Mutation Damage Score

0.9302

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.7%

Validation Efficiency

96% (52/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound polypeptide N-acetylgalactosaminyltransferase that is found in the Golgi. The encoded protein catalyzes the first step in the mucin-type O-glycosylation of Golgi proteins, transfering an N-acetyl-D-galactosamine residue to a serine or threonine residue on the protein receptor. [provided by RefSeq, Aug 2016]
PHENOTYPE: An unpublished knockout mutation is reported to have no overt phenotypic consequences. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
Adamts2	A	G	11: 50,781,869	E648G	probably damaging	Het
Ankrd55	A	G	13: 112,355,939	S187G	probably benign	Het
BC080695	T	C	4: 143,571,127	L39P	probably damaging	Het
C87414	T	A	5: 93,637,797	D208V	probably benign	Het
Cd44	C	A	2: 102,865,370	E52D	probably damaging	Het
Col6a5	T	A	9: 105,937,005	I603F	unknown	Het
Dmxl2	C	A	9: 54,460,987	R233L	probably damaging	Het
Dopey1	T	C	9: 86,506,259	F429L	probably damaging	Het
Epsti1	T	G	14: 77,986,682		probably null	Het
Erfe	G	T	1: 91,370,716		probably null	Het
Gm1330	T	C	2: 149,002,986		probably benign	Het
Gm6181	G	A	7: 52,755,616		noncoding transcript	Het
Irak2	T	A	6: 113,665,811	V68D	probably benign	Het
Kdm1a	A	G	4: 136,557,358		probably benign	Het
Kidins220	C	A	12: 24,992,297	Q198K	probably damaging	Het
Lgr5	A	G	10: 115,452,339	V728A	possibly damaging	Het
Micall2	G	A	5: 139,716,447	T347M	probably damaging	Het
Mrap2	T	C	9: 87,182,703	F166L	possibly damaging	Het
Msh3	A	T	13: 92,309,434		probably benign	Het
Mul1	T	A	4: 138,439,349	L238Q	probably damaging	Het
Nuak1	G	T	10: 84,374,984	H413Q	probably benign	Het
Olfr1408	T	C	1: 173,130,917	Q100R	possibly damaging	Het
Pcnt	C	T	10: 76,412,168	A931T	probably damaging	Het
Pddc1	A	T	7: 141,406,806		probably benign	Het
Psmb4	T	C	3: 94,884,942	Y223C	probably damaging	Het
Rbm15b	G	T	9: 106,886,102	A289E	possibly damaging	Het
Reg3b	T	A	6: 78,372,128	V79E	probably damaging	Het
Rsl1	A	G	13: 67,181,981	I164M	probably damaging	Het
Rtp1	T	C	16: 23,431,535	F217L	probably benign	Het
Sfmbt1	T	C	14: 30,790,770	L360P	probably damaging	Het
Sorbs2	T	C	8: 45,795,785	V611A	probably damaging	Het
Tenm4	T	A	7: 96,893,086	D1935E	probably damaging	Het
Tep1	T	C	14: 50,855,587		probably null	Het
Tmppe	T	G	9: 114,405,481	S283A	probably benign	Het
Tmtc1	A	G	6: 148,269,987		probably benign	Het
Trp63	T	C	16: 25,889,010	I552T	unknown	Het
Tspan2	C	A	3: 102,749,835	D45E	probably benign	Het
Ubr1	T	C	2: 120,882,264	E1396G	probably benign	Het
Usp17lc	A	T	7: 103,418,661	T388S	probably benign	Het
Wdr46	T	C	17: 33,948,837	V508A	possibly damaging	Het
Zcchc11	T	A	4: 108,520,292	D966E	possibly damaging	Het
Zfp462	T	A	4: 55,010,667	Y878N	probably damaging	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het
Zfp954	T	A	7: 7,115,715	T277S	probably benign	Het

Other mutations in Galnt5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00230:Galnt5	APN	2	57998973	missense	probably benign
IGL00515:Galnt5	APN	2	57999068	missense	probably benign	0.02
IGL00950:Galnt5	APN	2	57999132	missense	probably benign	0.00
IGL00973:Galnt5	APN	2	57998939	missense	probably benign	0.02
IGL01152:Galnt5	APN	2	58025393	missense	probably benign	0.17
IGL01305:Galnt5	APN	2	58025342	nonsense	probably null
IGL01661:Galnt5	APN	2	57999482	missense	probably benign	0.03
IGL01719:Galnt5	APN	2	57998543	missense	probably damaging	1.00
IGL02165:Galnt5	APN	2	57998865	missense	probably benign
IGL02795:Galnt5	APN	2	58027871	missense	probably damaging	1.00
IGL02943:Galnt5	APN	2	57999768	missense	probably damaging	1.00
IGL03218:Galnt5	APN	2	57999389	missense	possibly damaging	0.59
ANU22:Galnt5	UTSW	2	58025342	nonsense	probably null
R0082:Galnt5	UTSW	2	57999035	missense	possibly damaging	0.92
R0113:Galnt5	UTSW	2	57998877	missense	probably benign
R0445:Galnt5	UTSW	2	57998950	missense	probably benign
R0517:Galnt5	UTSW	2	58035373	splice site	probably benign
R0609:Galnt5	UTSW	2	58024625	missense	possibly damaging	0.90
R0639:Galnt5	UTSW	2	57999395	missense	probably benign	0.07
R0646:Galnt5	UTSW	2	57999085	missense	probably benign	0.00
R0677:Galnt5	UTSW	2	57998980	nonsense	probably null
R1808:Galnt5	UTSW	2	58026125	missense	probably benign	0.24
R1927:Galnt5	UTSW	2	57998603	missense	probably benign	0.00
R1980:Galnt5	UTSW	2	58024723	critical splice donor site	probably null
R2517:Galnt5	UTSW	2	57999413	missense	probably benign	0.00
R4044:Galnt5	UTSW	2	57998460	missense	probably damaging	1.00
R4154:Galnt5	UTSW	2	57998493	missense	probably damaging	1.00
R4411:Galnt5	UTSW	2	57999195	missense	probably benign	0.01
R4703:Galnt5	UTSW	2	57998907	missense	possibly damaging	0.96
R4767:Galnt5	UTSW	2	58028144	missense	possibly damaging	0.91
R5497:Galnt5	UTSW	2	58025328	missense	probably damaging	0.99
R5506:Galnt5	UTSW	2	57999625	missense	probably benign
R5548:Galnt5	UTSW	2	58014910	missense	probably damaging	0.99
R5758:Galnt5	UTSW	2	57998430	missense	probably benign	0.19
R5937:Galnt5	UTSW	2	58038937	missense	probably benign	0.00
R6237:Galnt5	UTSW	2	58035249	missense	probably damaging	0.96
R6805:Galnt5	UTSW	2	58035299	missense	possibly damaging	0.82
R6959:Galnt5	UTSW	2	57999219	missense	probably benign	0.39
R7070:Galnt5	UTSW	2	57998609	missense	probably benign	0.00
R7179:Galnt5	UTSW	2	57998609	missense	probably benign	0.06
R7347:Galnt5	UTSW	2	58017193	missense	probably benign	0.33
R7419:Galnt5	UTSW	2	58014925	missense	probably damaging	1.00
R7426:Galnt5	UTSW	2	58017139	missense	probably damaging	0.99
R7492:Galnt5	UTSW	2	58026036	splice site	probably null
R7539:Galnt5	UTSW	2	58035230	missense	probably damaging	0.99
R7623:Galnt5	UTSW	2	58017210	missense	probably damaging	0.99
R8135:Galnt5	UTSW	2	58014868	missense	probably damaging	1.00
R8155:Galnt5	UTSW	2	57999415	missense	probably benign	0.01
R8544:Galnt5	UTSW	2	58017148	missense	probably damaging	1.00
R9267:Galnt5	UTSW	2	58035208	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- CTGTGCTTATATCCTGGCCCAG -3'
(R):5'- GGCAATGCCTGAAACATACAG -3'

Sequencing Primer
(F):5'- CAGGTGTGCAGAGCAACTAGTTC -3'
(R):5'- TGTACTACACGCATGCAGTG -3'

Posted On

2016-06-15