Incidental Mutation 'R5118:Cd44'
ID392722
Institutional Source Beutler Lab
Gene Symbol Cd44
Ensembl Gene ENSMUSG00000005087
Gene NameCD44 antigen
SynonymsPgp-1, HERMES, Ly-24
MMRRC Submission 042706-MU
Accession Numbers

Genbank: NM_009851; MGI: 88338

Is this an essential gene? Possibly non essential (E-score: 0.307) question?
Stock #R5118 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location102811141-102901665 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 102865370 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 52 (E52D)
Ref Sequence ENSEMBL: ENSMUSP00000097265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005218] [ENSMUST00000060516] [ENSMUST00000099673] [ENSMUST00000111190] [ENSMUST00000111191] [ENSMUST00000111192] [ENSMUST00000111194] [ENSMUST00000111198]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005218
AA Change: E52D

PolyPhen 2 Score 0.649 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000005218
Gene: ENSMUSG00000005087
AA Change: E52D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 251 276 N/A INTRINSIC
low complexity region 429 439 N/A INTRINSIC
low complexity region 640 653 N/A INTRINSIC
low complexity region 689 703 N/A INTRINSIC
PDB:2ZPY|B 710 729 1e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000060516
AA Change: E52D

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000062330
Gene: ENSMUSG00000005087
AA Change: E52D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 229 239 N/A INTRINSIC
low complexity region 440 453 N/A INTRINSIC
low complexity region 489 503 N/A INTRINSIC
PDB:2ZPY|B 510 529 1e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000099673
AA Change: E52D

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097265
Gene: ENSMUSG00000005087
AA Change: E52D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 225 238 N/A INTRINSIC
low complexity region 274 288 N/A INTRINSIC
PDB:2ZPY|B 295 314 1e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000111190
AA Change: E52D

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106821
Gene: ENSMUSG00000005087
AA Change: E52D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 324 337 N/A INTRINSIC
low complexity region 373 387 N/A INTRINSIC
PDB:2ZPY|B 394 413 8e-7 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000111191
AA Change: E52D

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106822
Gene: ENSMUSG00000005087
AA Change: E52D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 358 371 N/A INTRINSIC
low complexity region 407 421 N/A INTRINSIC
PDB:2ZPY|B 428 447 9e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000111192
AA Change: E52D

PolyPhen 2 Score 0.419 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106823
Gene: ENSMUSG00000005087
AA Change: E52D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 294 307 N/A INTRINSIC
low complexity region 343 357 N/A INTRINSIC
PDB:2ZPY|B 364 383 1e-6 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000111194
AA Change: E52D

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106825
Gene: ENSMUSG00000005087
AA Change: E52D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 268 278 N/A INTRINSIC
low complexity region 302 312 N/A INTRINSIC
low complexity region 437 450 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
PDB:2ZPY|B 507 526 1e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000111198
AA Change: E52D

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000106829
Gene: ENSMUSG00000005087
AA Change: E52D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 306 316 N/A INTRINSIC
low complexity region 517 530 N/A INTRINSIC
low complexity region 566 580 N/A INTRINSIC
PDB:2ZPY|B 587 606 1e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124624
Meta Mutation Damage Score 0.8609 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell-surface glycoprotein involved in cell-cell interactions, cell adhesion and migration. It is a receptor for hyaluronic acid (HA) and can also interact with other ligands, such as osteopontin, collagens, and matrix metalloproteinases (MMPs). This protein participates in a wide variety of cellular functions including lymphocyte activation, recirculation and homing, hematopoiesis, and tumor metastasis. Transcripts for this gene undergo complex alternative splicing that results in many functionally distinct isoforms, however, the full length nature of some of these variants has not been determined. Alternative splicing is the basis for the structural and functional diversity of this protein, and may be related to tumor metastasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired T lymphocyte trafficking resulting in muted inflammatory responses, altered myeloid progenitor distribution, reduced growth of tumors, and impaired uterine involution and maintenance of lactation. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(4) Targeted, other(3)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Adamts2 A G 11: 50,781,869 E648G probably damaging Het
Ankrd55 A G 13: 112,355,939 S187G probably benign Het
BC080695 T C 4: 143,571,127 L39P probably damaging Het
C87414 T A 5: 93,637,797 D208V probably benign Het
Col6a5 T A 9: 105,937,005 I603F unknown Het
Dmxl2 C A 9: 54,460,987 R233L probably damaging Het
Dopey1 T C 9: 86,506,259 F429L probably damaging Het
Epsti1 T G 14: 77,986,682 probably null Het
Erfe G T 1: 91,370,716 probably null Het
Galnt5 A G 2: 58,015,003 D526G probably damaging Het
Gm1330 T C 2: 149,002,986 probably benign Het
Gm6181 G A 7: 52,755,616 noncoding transcript Het
Irak2 T A 6: 113,665,811 V68D probably benign Het
Kdm1a A G 4: 136,557,358 probably benign Het
Kidins220 C A 12: 24,992,297 Q198K probably damaging Het
Lgr5 A G 10: 115,452,339 V728A possibly damaging Het
Micall2 G A 5: 139,716,447 T347M probably damaging Het
Mrap2 T C 9: 87,182,703 F166L possibly damaging Het
Msh3 A T 13: 92,309,434 probably benign Het
Mul1 T A 4: 138,439,349 L238Q probably damaging Het
Nuak1 G T 10: 84,374,984 H413Q probably benign Het
Olfr1408 T C 1: 173,130,917 Q100R possibly damaging Het
Pcnt C T 10: 76,412,168 A931T probably damaging Het
Pddc1 A T 7: 141,406,806 probably benign Het
Psmb4 T C 3: 94,884,942 Y223C probably damaging Het
Rbm15b G T 9: 106,886,102 A289E possibly damaging Het
Reg3b T A 6: 78,372,128 V79E probably damaging Het
Rsl1 A G 13: 67,181,981 I164M probably damaging Het
Rtp1 T C 16: 23,431,535 F217L probably benign Het
Sfmbt1 T C 14: 30,790,770 L360P probably damaging Het
Sorbs2 T C 8: 45,795,785 V611A probably damaging Het
Tenm4 T A 7: 96,893,086 D1935E probably damaging Het
Tep1 T C 14: 50,855,587 probably null Het
Tmppe T G 9: 114,405,481 S283A probably benign Het
Tmtc1 A G 6: 148,269,987 probably benign Het
Trp63 T C 16: 25,889,010 I552T unknown Het
Tspan2 C A 3: 102,749,835 D45E probably benign Het
Ubr1 T C 2: 120,882,264 E1396G probably benign Het
Usp17lc A T 7: 103,418,661 T388S probably benign Het
Wdr46 T C 17: 33,948,837 V508A possibly damaging Het
Zcchc11 T A 4: 108,520,292 D966E possibly damaging Het
Zfp462 T A 4: 55,010,667 Y878N probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp954 T A 7: 7,115,715 T277S probably benign Het
Other mutations in Cd44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Cd44 APN 2 102855947 missense possibly damaging 0.73
IGL01087:Cd44 APN 2 102822262 missense probably damaging 1.00
IGL01413:Cd44 APN 2 102814287 missense probably damaging 0.99
IGL01830:Cd44 APN 2 102842258 splice site probably benign
IGL02221:Cd44 APN 2 102846513 missense probably benign 0.01
IGL02271:Cd44 APN 2 102831387 missense possibly damaging 0.93
IGL02552:Cd44 APN 2 102848731 missense probably benign 0.01
IGL02861:Cd44 APN 2 102832481 critical splice donor site probably null
IGL03309:Cd44 APN 2 102814177 missense probably damaging 1.00
IGL03352:Cd44 APN 2 102845414 intron probably benign
Jialin UTSW 2 102865370 missense probably damaging 0.99
Kale UTSW 2 102824303 missense probably damaging 0.99
N/A - 535:Cd44 UTSW 2 102814189 missense possibly damaging 0.50
R0488:Cd44 UTSW 2 102834219 splice site probably benign
R1441:Cd44 UTSW 2 102846418 missense probably damaging 0.99
R1482:Cd44 UTSW 2 102831383 missense probably damaging 1.00
R1497:Cd44 UTSW 2 102842955 splice site probably null
R1803:Cd44 UTSW 2 102834252 missense probably damaging 1.00
R1952:Cd44 UTSW 2 102853087 missense probably damaging 0.98
R2093:Cd44 UTSW 2 102814284 missense probably damaging 1.00
R2180:Cd44 UTSW 2 102828610 missense possibly damaging 0.66
R2425:Cd44 UTSW 2 102861586 missense probably damaging 1.00
R3687:Cd44 UTSW 2 102901350 utr 5 prime probably null
R3820:Cd44 UTSW 2 102901393 unclassified probably null
R3821:Cd44 UTSW 2 102901393 unclassified probably null
R3822:Cd44 UTSW 2 102901393 unclassified probably null
R4060:Cd44 UTSW 2 102901342 missense probably damaging 1.00
R4633:Cd44 UTSW 2 102853047 missense possibly damaging 0.86
R4647:Cd44 UTSW 2 102837929 missense possibly damaging 0.68
R4780:Cd44 UTSW 2 102861565 missense probably damaging 1.00
R5087:Cd44 UTSW 2 102831354 missense possibly damaging 0.83
R5449:Cd44 UTSW 2 102832546 missense probably damaging 1.00
R5642:Cd44 UTSW 2 102901342 missense probably damaging 1.00
R5928:Cd44 UTSW 2 102824303 missense probably damaging 0.99
R5995:Cd44 UTSW 2 102861670 missense probably damaging 1.00
R5999:Cd44 UTSW 2 102845397 missense probably benign 0.42
R7050:Cd44 UTSW 2 102814137 missense probably damaging 0.99
R7350:Cd44 UTSW 2 102834262 missense probably benign 0.19
R7797:Cd44 UTSW 2 102848734 missense probably benign 0.34
R7866:Cd44 UTSW 2 102842259 critical splice donor site probably null
R8138:Cd44 UTSW 2 102832497 missense probably benign 0.00
R8185:Cd44 UTSW 2 102824320 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- CTTATTCAACTGTCAGGGAGGAG -3'
(R):5'- GCATGTTTGGCTTCTCCCAATG -3'

Sequencing Primer
(F):5'- GAGGAGCCTTCCAGCCATAAG -3'
(R):5'- CCCAATGCCCCATCTGG -3'
Posted On2016-06-15