Mutagenetix > Incidental Mutations

Incidental Mutation 'R5118:Ubr1'

392723

Institutional Source

Beutler Lab

Gene Symbol

Ubr1

Ensembl Gene

ENSMUSG00000027272

Gene Name

ubiquitin protein ligase E3 component n-recognin 1

Synonyms

E3 alpha

MMRRC Submission

042706-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.808) question?

Stock #

R5118 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

120860269-120970715 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 120882264 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1396 (E1396G)

Ref Sequence

ENSEMBL: ENSMUSP00000028728 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028728]

AlphaFold

O70481

Predicted Effect

probably benign
Transcript: ENSMUST00000028728
AA Change: E1396G

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000028728
Gene: ENSMUSG00000027272
AA Change: E1396G

Domain	Start	End	E-Value	Type
ZnF_UBR1	97	167	1.24e-35	SMART
Pfam:ClpS	221	301	8e-24	PFAM
low complexity region	918	936	N/A	INTRINSIC
low complexity region	1017	1030	N/A	INTRINSIC
low complexity region	1070	1081	N/A	INTRINSIC
Blast:RING	1101	1203	4e-34	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135891

Meta Mutation Damage Score

0.1295

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.7%

Validation Efficiency

96% (52/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-end rule pathway is one proteolytic pathway of the ubiquitin system. The recognition component of this pathway, encoded by this gene, binds to a destabilizing N-terminal residue of a substrate protein and participates in the formation of a substrate-linked multiubiquitin chain. This leads to the eventual degradation of the substrate protein. The protein described in this record has a RING-type zinc finger and a UBR-type zinc finger. Mutations in this gene have been associated with Johanson-Blizzard syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have 20% lower body weight and reduced muscle and adipose tissue. Skeletal muscle lacks a mechanism for targeting proteins for rapid catabolism. Aberrant regulation of fatty acid synthase upon starvation is also observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
Adamts2	A	G	11: 50,781,869	E648G	probably damaging	Het
Ankrd55	A	G	13: 112,355,939	S187G	probably benign	Het
BC080695	T	C	4: 143,571,127	L39P	probably damaging	Het
C87414	T	A	5: 93,637,797	D208V	probably benign	Het
Cd44	C	A	2: 102,865,370	E52D	probably damaging	Het
Col6a5	T	A	9: 105,937,005	I603F	unknown	Het
Dmxl2	C	A	9: 54,460,987	R233L	probably damaging	Het
Dopey1	T	C	9: 86,506,259	F429L	probably damaging	Het
Epsti1	T	G	14: 77,986,682		probably null	Het
Erfe	G	T	1: 91,370,716		probably null	Het
Galnt5	A	G	2: 58,015,003	D526G	probably damaging	Het
Gm1330	T	C	2: 149,002,986		probably benign	Het
Gm6181	G	A	7: 52,755,616		noncoding transcript	Het
Irak2	T	A	6: 113,665,811	V68D	probably benign	Het
Kdm1a	A	G	4: 136,557,358		probably benign	Het
Kidins220	C	A	12: 24,992,297	Q198K	probably damaging	Het
Lgr5	A	G	10: 115,452,339	V728A	possibly damaging	Het
Micall2	G	A	5: 139,716,447	T347M	probably damaging	Het
Mrap2	T	C	9: 87,182,703	F166L	possibly damaging	Het
Msh3	A	T	13: 92,309,434		probably benign	Het
Mul1	T	A	4: 138,439,349	L238Q	probably damaging	Het
Nuak1	G	T	10: 84,374,984	H413Q	probably benign	Het
Olfr1408	T	C	1: 173,130,917	Q100R	possibly damaging	Het
Pcnt	C	T	10: 76,412,168	A931T	probably damaging	Het
Pddc1	A	T	7: 141,406,806		probably benign	Het
Psmb4	T	C	3: 94,884,942	Y223C	probably damaging	Het
Rbm15b	G	T	9: 106,886,102	A289E	possibly damaging	Het
Reg3b	T	A	6: 78,372,128	V79E	probably damaging	Het
Rsl1	A	G	13: 67,181,981	I164M	probably damaging	Het
Rtp1	T	C	16: 23,431,535	F217L	probably benign	Het
Sfmbt1	T	C	14: 30,790,770	L360P	probably damaging	Het
Sorbs2	T	C	8: 45,795,785	V611A	probably damaging	Het
Tenm4	T	A	7: 96,893,086	D1935E	probably damaging	Het
Tep1	T	C	14: 50,855,587		probably null	Het
Tmppe	T	G	9: 114,405,481	S283A	probably benign	Het
Tmtc1	A	G	6: 148,269,987		probably benign	Het
Trp63	T	C	16: 25,889,010	I552T	unknown	Het
Tspan2	C	A	3: 102,749,835	D45E	probably benign	Het
Usp17lc	A	T	7: 103,418,661	T388S	probably benign	Het
Wdr46	T	C	17: 33,948,837	V508A	possibly damaging	Het
Zcchc11	T	A	4: 108,520,292	D966E	possibly damaging	Het
Zfp462	T	A	4: 55,010,667	Y878N	probably damaging	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het
Zfp954	T	A	7: 7,115,715	T277S	probably benign	Het

Other mutations in Ubr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00552:Ubr1	APN	2	120875407	missense	possibly damaging	0.65
IGL00570:Ubr1	APN	2	120941093	missense	possibly damaging	0.93
IGL00990:Ubr1	APN	2	120930872	missense	probably damaging	1.00
IGL01124:Ubr1	APN	2	120914905	missense	probably benign
IGL01346:Ubr1	APN	2	120873122	critical splice donor site	probably null
IGL01368:Ubr1	APN	2	120941131	splice site	probably benign
IGL01539:Ubr1	APN	2	120926013	missense	possibly damaging	0.79
IGL01862:Ubr1	APN	2	120934342	missense	possibly damaging	0.81
IGL01965:Ubr1	APN	2	120875398	missense	probably damaging	0.99
IGL01984:Ubr1	APN	2	120921386	missense	probably damaging	0.99
IGL02184:Ubr1	APN	2	120900508	missense	probably benign	0.00
IGL02208:Ubr1	APN	2	120946349	missense	probably benign	0.00
IGL02415:Ubr1	APN	2	120970603	utr 5 prime	probably benign
IGL02517:Ubr1	APN	2	120864373	missense	possibly damaging	0.69
IGL02614:Ubr1	APN	2	120870979	splice site	probably benign
IGL02627:Ubr1	APN	2	120940991	missense	probably damaging	1.00
IGL02718:Ubr1	APN	2	120914883	missense	probably damaging	1.00
IGL02741:Ubr1	APN	2	120941091	missense	probably benign	0.01
IGL02939:Ubr1	APN	2	120881183	critical splice acceptor site	probably null
IGL03081:Ubr1	APN	2	120961156	missense	possibly damaging	0.83
IGL03310:Ubr1	APN	2	120864417	missense	probably damaging	1.00
IGL03370:Ubr1	APN	2	120895160	missense	probably benign
I1329:Ubr1	UTSW	2	120934294	splice site	probably benign
R0022:Ubr1	UTSW	2	120961173	splice site	probably benign
R0345:Ubr1	UTSW	2	120904103	splice site	probably null
R0373:Ubr1	UTSW	2	120946657	missense	probably benign	0.01
R0393:Ubr1	UTSW	2	120906946	missense	probably damaging	1.00
R0543:Ubr1	UTSW	2	120881093	missense	probably damaging	1.00
R0559:Ubr1	UTSW	2	120947883	nonsense	probably null
R0723:Ubr1	UTSW	2	120881101	nonsense	probably null
R1178:Ubr1	UTSW	2	120926029	nonsense	probably null
R1401:Ubr1	UTSW	2	120955644	missense	probably benign	0.01
R1485:Ubr1	UTSW	2	120961098	missense	probably benign	0.03
R1572:Ubr1	UTSW	2	120935319	splice site	probably benign
R1920:Ubr1	UTSW	2	120930968	missense	probably benign	0.11
R1921:Ubr1	UTSW	2	120930968	missense	probably benign	0.11
R1997:Ubr1	UTSW	2	120946273	critical splice donor site	probably null
R2129:Ubr1	UTSW	2	120942553	missense	probably benign	0.35
R2147:Ubr1	UTSW	2	120864330	missense	probably damaging	1.00
R2191:Ubr1	UTSW	2	120926047	missense	probably damaging	0.96
R2288:Ubr1	UTSW	2	120909482	missense	probably damaging	1.00
R3409:Ubr1	UTSW	2	120963448	missense	probably benign	0.02
R3930:Ubr1	UTSW	2	120916470	missense	probably benign	0.20
R3979:Ubr1	UTSW	2	120862687	missense	probably benign	0.11
R4172:Ubr1	UTSW	2	120946622	splice site	probably null
R4173:Ubr1	UTSW	2	120946622	splice site	probably null
R4174:Ubr1	UTSW	2	120946622	splice site	probably null
R4241:Ubr1	UTSW	2	120934386	missense	possibly damaging	0.69
R4366:Ubr1	UTSW	2	120970603	utr 5 prime	probably benign
R4371:Ubr1	UTSW	2	120895066	splice site	probably null
R4449:Ubr1	UTSW	2	120946381	missense	possibly damaging	0.84
R4533:Ubr1	UTSW	2	120942482	missense	possibly damaging	0.86
R4656:Ubr1	UTSW	2	120926013	missense	probably benign	0.35
R4765:Ubr1	UTSW	2	120963442	nonsense	probably null
R4928:Ubr1	UTSW	2	120914938	missense	probably damaging	1.00
R4987:Ubr1	UTSW	2	120963566	missense	probably benign	0.00
R5033:Ubr1	UTSW	2	120911997	critical splice donor site	probably null
R5108:Ubr1	UTSW	2	120963422	missense	probably benign	0.20
R5211:Ubr1	UTSW	2	120893170	missense	possibly damaging	0.92
R5215:Ubr1	UTSW	2	120904044	missense	probably benign	0.00
R5449:Ubr1	UTSW	2	120963500	missense	probably benign
R5452:Ubr1	UTSW	2	120868302	missense	possibly damaging	0.95
R5582:Ubr1	UTSW	2	120915407	missense	probably benign
R5610:Ubr1	UTSW	2	120892112	missense	probably benign	0.04
R5637:Ubr1	UTSW	2	120963517	missense	possibly damaging	0.68
R5808:Ubr1	UTSW	2	120961092	missense	possibly damaging	0.63
R5845:Ubr1	UTSW	2	120904005	missense	probably benign
R5979:Ubr1	UTSW	2	120946382	missense	probably benign	0.07
R6044:Ubr1	UTSW	2	120862721	missense	probably benign	0.38
R6146:Ubr1	UTSW	2	120893209	missense	probably damaging	0.98
R6252:Ubr1	UTSW	2	120906895	missense	probably benign	0.21
R6389:Ubr1	UTSW	2	120881039	missense	probably benign	0.03
R6600:Ubr1	UTSW	2	120915399	missense	probably benign	0.00
R6670:Ubr1	UTSW	2	120924130	critical splice donor site	probably null
R6731:Ubr1	UTSW	2	120955640	missense	probably null	0.99
R6836:Ubr1	UTSW	2	120896675	splice site	probably null
R6994:Ubr1	UTSW	2	120963593	missense	probably benign
R7121:Ubr1	UTSW	2	120875498	missense	probably benign	0.00
R7204:Ubr1	UTSW	2	120904077	missense	possibly damaging	0.49
R7209:Ubr1	UTSW	2	120862765	missense	probably benign	0.04
R7434:Ubr1	UTSW	2	120862680	missense	probably benign
R7457:Ubr1	UTSW	2	120917828	missense	probably benign	0.35
R7464:Ubr1	UTSW	2	120889774	critical splice donor site	probably null
R7519:Ubr1	UTSW	2	120875444	missense	possibly damaging	0.63
R7574:Ubr1	UTSW	2	120873191	missense	possibly damaging	0.93
R8030:Ubr1	UTSW	2	120934374	missense	probably damaging	0.99
R8085:Ubr1	UTSW	2	120934417	nonsense	probably null
R8221:Ubr1	UTSW	2	120961104	missense	probably damaging	0.97
R8241:Ubr1	UTSW	2	120963456	missense	possibly damaging	0.80
R8291:Ubr1	UTSW	2	120911115	missense	probably benign
R8293:Ubr1	UTSW	2	120862721	missense	probably benign	0.38
R8420:Ubr1	UTSW	2	120870995	missense	probably benign
R8489:Ubr1	UTSW	2	120881067	missense	probably benign	0.42
R8708:Ubr1	UTSW	2	120866483	missense	probably benign	0.27
R8856:Ubr1	UTSW	2	120904042	missense	probably damaging	1.00
R8995:Ubr1	UTSW	2	120866553	missense	probably damaging	1.00
R9153:Ubr1	UTSW	2	120925988	missense	probably benign	0.00
R9155:Ubr1	UTSW	2	120924134	missense	possibly damaging	0.84
R9156:Ubr1	UTSW	2	120873122	critical splice donor site	probably null
R9194:Ubr1	UTSW	2	120947844	missense	probably damaging	1.00
R9320:Ubr1	UTSW	2	120896519	missense	probably benign	0.04
R9401:Ubr1	UTSW	2	120935284	missense	probably benign	0.06
R9430:Ubr1	UTSW	2	120904025	missense	possibly damaging	0.59

Predicted Primers

PCR Primer
(F):5'- AGCTTCCATGGTAATTCACTGCATATG -3'
(R):5'- CAAGGCCTGACACTGTTACTG -3'

Sequencing Primer
(F):5'- AAGGGAGTGGGGAAGACC -3'
(R):5'- CCTGACACTGTTACTGAGGCTATG -3'

Posted On

2016-06-15