Mutagenetix > Incidental Mutation

Incidental Mutation 'R5118:Ubr1'

392723

Institutional Source

Beutler Lab

Gene Symbol

Ubr1

Ensembl Gene

ENSMUSG00000027272

Gene Name

ubiquitin protein ligase E3 component n-recognin 1

Synonyms

E3 alpha

MMRRC Submission

042706-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.826) question?

Stock #

R5118 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

120690750-120801196 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 120712745 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1396 (E1396G)

Ref Sequence

ENSEMBL: ENSMUSP00000028728 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028728]

AlphaFold

O70481

Predicted Effect

probably benign
Transcript: ENSMUST00000028728
AA Change: E1396G

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000028728
Gene: ENSMUSG00000027272
AA Change: E1396G

Domain	Start	End	E-Value	Type
ZnF_UBR1	97	167	1.24e-35	SMART
Pfam:ClpS	221	301	8e-24	PFAM
low complexity region	918	936	N/A	INTRINSIC
low complexity region	1017	1030	N/A	INTRINSIC
low complexity region	1070	1081	N/A	INTRINSIC
Blast:RING	1101	1203	4e-34	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135891

Meta Mutation Damage Score

0.1295

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.7%

Validation Efficiency

96% (52/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-end rule pathway is one proteolytic pathway of the ubiquitin system. The recognition component of this pathway, encoded by this gene, binds to a destabilizing N-terminal residue of a substrate protein and participates in the formation of a substrate-linked multiubiquitin chain. This leads to the eventual degradation of the substrate protein. The protein described in this record has a RING-type zinc finger and a UBR-type zinc finger. Mutations in this gene have been associated with Johanson-Blizzard syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have 20% lower body weight and reduced muscle and adipose tissue. Skeletal muscle lacks a mechanism for targeting proteins for rapid catabolism. Aberrant regulation of fatty acid synthase upon starvation is also observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,211,320 (GRCm39)	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,211,321 (GRCm39)	E685V	possibly damaging	Het
Adamts2	A	G	11: 50,672,696 (GRCm39)	E648G	probably damaging	Het
Ankrd55	A	G	13: 112,492,473 (GRCm39)	S187G	probably benign	Het
Cd44	C	A	2: 102,695,715 (GRCm39)	E52D	probably damaging	Het
Col6a5	T	A	9: 105,814,204 (GRCm39)	I603F	unknown	Het
Dmxl2	C	A	9: 54,368,271 (GRCm39)	R233L	probably damaging	Het
Dop1a	T	C	9: 86,388,312 (GRCm39)	F429L	probably damaging	Het
Epsti1	T	G	14: 78,224,122 (GRCm39)		probably null	Het
Erfe	G	T	1: 91,298,438 (GRCm39)		probably null	Het
Galnt5	A	G	2: 57,905,015 (GRCm39)	D526G	probably damaging	Het
Gatd1	A	T	7: 140,986,719 (GRCm39)		probably benign	Het
Gm1330	T	C	2: 148,844,906 (GRCm39)		probably benign	Het
Gm6181	G	A	7: 52,405,364 (GRCm39)		noncoding transcript	Het
Irak2	T	A	6: 113,642,772 (GRCm39)	V68D	probably benign	Het
Kdm1a	A	G	4: 136,284,669 (GRCm39)		probably benign	Het
Kidins220	C	A	12: 25,042,296 (GRCm39)	Q198K	probably damaging	Het
Lgr5	A	G	10: 115,288,244 (GRCm39)	V728A	possibly damaging	Het
Micall2	G	A	5: 139,702,202 (GRCm39)	T347M	probably damaging	Het
Mrap2	T	C	9: 87,064,756 (GRCm39)	F166L	possibly damaging	Het
Msh3	A	T	13: 92,445,942 (GRCm39)		probably benign	Het
Mul1	T	A	4: 138,166,660 (GRCm39)	L238Q	probably damaging	Het
Nuak1	G	T	10: 84,210,848 (GRCm39)	H413Q	probably benign	Het
Or10j27	T	C	1: 172,958,484 (GRCm39)	Q100R	possibly damaging	Het
Pcnt	C	T	10: 76,248,002 (GRCm39)	A931T	probably damaging	Het
Pramel20	T	C	4: 143,297,697 (GRCm39)	L39P	probably damaging	Het
Pramel34	T	A	5: 93,785,656 (GRCm39)	D208V	probably benign	Het
Psmb4	T	C	3: 94,792,253 (GRCm39)	Y223C	probably damaging	Het
Rbm15b	G	T	9: 106,763,301 (GRCm39)	A289E	possibly damaging	Het
Reg3b	T	A	6: 78,349,111 (GRCm39)	V79E	probably damaging	Het
Rsl1	A	G	13: 67,330,045 (GRCm39)	I164M	probably damaging	Het
Rtp1	T	C	16: 23,250,285 (GRCm39)	F217L	probably benign	Het
Sfmbt1	T	C	14: 30,512,727 (GRCm39)	L360P	probably damaging	Het
Sorbs2	T	C	8: 46,248,822 (GRCm39)	V611A	probably damaging	Het
Tenm4	T	A	7: 96,542,293 (GRCm39)	D1935E	probably damaging	Het
Tep1	T	C	14: 51,093,044 (GRCm39)		probably null	Het
Tmppe	T	G	9: 114,234,549 (GRCm39)	S283A	probably benign	Het
Tmtc1	A	G	6: 148,171,485 (GRCm39)		probably benign	Het
Trp63	T	C	16: 25,707,760 (GRCm39)	I552T	unknown	Het
Tspan2	C	A	3: 102,657,151 (GRCm39)	D45E	probably benign	Het
Tut4	T	A	4: 108,377,489 (GRCm39)	D966E	possibly damaging	Het
Usp17lc	A	T	7: 103,067,868 (GRCm39)	T388S	probably benign	Het
Wdr46	T	C	17: 34,167,811 (GRCm39)	V508A	possibly damaging	Het
Zfp462	T	A	4: 55,010,667 (GRCm39)	Y878N	probably damaging	Het
Zfp703	C	T	8: 27,469,233 (GRCm39)	P299L	probably damaging	Het
Zfp954	T	A	7: 7,118,714 (GRCm39)	T277S	probably benign	Het

Other mutations in Ubr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00552:Ubr1	APN	2	120,705,888 (GRCm39)	missense	possibly damaging	0.65
IGL00570:Ubr1	APN	2	120,771,574 (GRCm39)	missense	possibly damaging	0.93
IGL00990:Ubr1	APN	2	120,761,353 (GRCm39)	missense	probably damaging	1.00
IGL01124:Ubr1	APN	2	120,745,386 (GRCm39)	missense	probably benign
IGL01346:Ubr1	APN	2	120,703,603 (GRCm39)	critical splice donor site	probably null
IGL01368:Ubr1	APN	2	120,771,612 (GRCm39)	splice site	probably benign
IGL01539:Ubr1	APN	2	120,756,494 (GRCm39)	missense	possibly damaging	0.79
IGL01862:Ubr1	APN	2	120,764,823 (GRCm39)	missense	possibly damaging	0.81
IGL01965:Ubr1	APN	2	120,705,879 (GRCm39)	missense	probably damaging	0.99
IGL01984:Ubr1	APN	2	120,751,867 (GRCm39)	missense	probably damaging	0.99
IGL02184:Ubr1	APN	2	120,730,989 (GRCm39)	missense	probably benign	0.00
IGL02208:Ubr1	APN	2	120,776,830 (GRCm39)	missense	probably benign	0.00
IGL02415:Ubr1	APN	2	120,801,084 (GRCm39)	utr 5 prime	probably benign
IGL02517:Ubr1	APN	2	120,694,854 (GRCm39)	missense	possibly damaging	0.69
IGL02614:Ubr1	APN	2	120,701,460 (GRCm39)	splice site	probably benign
IGL02627:Ubr1	APN	2	120,771,472 (GRCm39)	missense	probably damaging	1.00
IGL02718:Ubr1	APN	2	120,745,364 (GRCm39)	missense	probably damaging	1.00
IGL02741:Ubr1	APN	2	120,771,572 (GRCm39)	missense	probably benign	0.01
IGL02939:Ubr1	APN	2	120,711,664 (GRCm39)	critical splice acceptor site	probably null
IGL03081:Ubr1	APN	2	120,791,637 (GRCm39)	missense	possibly damaging	0.83
IGL03310:Ubr1	APN	2	120,694,898 (GRCm39)	missense	probably damaging	1.00
IGL03370:Ubr1	APN	2	120,725,641 (GRCm39)	missense	probably benign
I1329:Ubr1	UTSW	2	120,764,775 (GRCm39)	splice site	probably benign
R0022:Ubr1	UTSW	2	120,791,654 (GRCm39)	splice site	probably benign
R0345:Ubr1	UTSW	2	120,734,584 (GRCm39)	splice site	probably null
R0373:Ubr1	UTSW	2	120,777,138 (GRCm39)	missense	probably benign	0.01
R0393:Ubr1	UTSW	2	120,737,427 (GRCm39)	missense	probably damaging	1.00
R0543:Ubr1	UTSW	2	120,711,574 (GRCm39)	missense	probably damaging	1.00
R0559:Ubr1	UTSW	2	120,778,364 (GRCm39)	nonsense	probably null
R0723:Ubr1	UTSW	2	120,711,582 (GRCm39)	nonsense	probably null
R1178:Ubr1	UTSW	2	120,756,510 (GRCm39)	nonsense	probably null
R1401:Ubr1	UTSW	2	120,786,125 (GRCm39)	missense	probably benign	0.01
R1485:Ubr1	UTSW	2	120,791,579 (GRCm39)	missense	probably benign	0.03
R1572:Ubr1	UTSW	2	120,765,800 (GRCm39)	splice site	probably benign
R1920:Ubr1	UTSW	2	120,761,449 (GRCm39)	missense	probably benign	0.11
R1921:Ubr1	UTSW	2	120,761,449 (GRCm39)	missense	probably benign	0.11
R1997:Ubr1	UTSW	2	120,776,754 (GRCm39)	critical splice donor site	probably null
R2129:Ubr1	UTSW	2	120,773,034 (GRCm39)	missense	probably benign	0.35
R2147:Ubr1	UTSW	2	120,694,811 (GRCm39)	missense	probably damaging	1.00
R2191:Ubr1	UTSW	2	120,756,528 (GRCm39)	missense	probably damaging	0.96
R2288:Ubr1	UTSW	2	120,739,963 (GRCm39)	missense	probably damaging	1.00
R3409:Ubr1	UTSW	2	120,793,929 (GRCm39)	missense	probably benign	0.02
R3930:Ubr1	UTSW	2	120,746,951 (GRCm39)	missense	probably benign	0.20
R3979:Ubr1	UTSW	2	120,693,168 (GRCm39)	missense	probably benign	0.11
R4172:Ubr1	UTSW	2	120,777,103 (GRCm39)	splice site	probably null
R4173:Ubr1	UTSW	2	120,777,103 (GRCm39)	splice site	probably null
R4174:Ubr1	UTSW	2	120,777,103 (GRCm39)	splice site	probably null
R4241:Ubr1	UTSW	2	120,764,867 (GRCm39)	missense	possibly damaging	0.69
R4366:Ubr1	UTSW	2	120,801,084 (GRCm39)	utr 5 prime	probably benign
R4371:Ubr1	UTSW	2	120,725,547 (GRCm39)	splice site	probably null
R4449:Ubr1	UTSW	2	120,776,862 (GRCm39)	missense	possibly damaging	0.84
R4533:Ubr1	UTSW	2	120,772,963 (GRCm39)	missense	possibly damaging	0.86
R4656:Ubr1	UTSW	2	120,756,494 (GRCm39)	missense	probably benign	0.35
R4765:Ubr1	UTSW	2	120,793,923 (GRCm39)	nonsense	probably null
R4928:Ubr1	UTSW	2	120,745,419 (GRCm39)	missense	probably damaging	1.00
R4987:Ubr1	UTSW	2	120,794,047 (GRCm39)	missense	probably benign	0.00
R5033:Ubr1	UTSW	2	120,742,478 (GRCm39)	critical splice donor site	probably null
R5108:Ubr1	UTSW	2	120,793,903 (GRCm39)	missense	probably benign	0.20
R5211:Ubr1	UTSW	2	120,723,651 (GRCm39)	missense	possibly damaging	0.92
R5215:Ubr1	UTSW	2	120,734,525 (GRCm39)	missense	probably benign	0.00
R5449:Ubr1	UTSW	2	120,793,981 (GRCm39)	missense	probably benign
R5452:Ubr1	UTSW	2	120,698,783 (GRCm39)	missense	possibly damaging	0.95
R5582:Ubr1	UTSW	2	120,745,888 (GRCm39)	missense	probably benign
R5610:Ubr1	UTSW	2	120,722,593 (GRCm39)	missense	probably benign	0.04
R5637:Ubr1	UTSW	2	120,793,998 (GRCm39)	missense	possibly damaging	0.68
R5808:Ubr1	UTSW	2	120,791,573 (GRCm39)	missense	possibly damaging	0.63
R5845:Ubr1	UTSW	2	120,734,486 (GRCm39)	missense	probably benign
R5979:Ubr1	UTSW	2	120,776,863 (GRCm39)	missense	probably benign	0.07
R6044:Ubr1	UTSW	2	120,693,202 (GRCm39)	missense	probably benign	0.38
R6146:Ubr1	UTSW	2	120,723,690 (GRCm39)	missense	probably damaging	0.98
R6252:Ubr1	UTSW	2	120,737,376 (GRCm39)	missense	probably benign	0.21
R6389:Ubr1	UTSW	2	120,711,520 (GRCm39)	missense	probably benign	0.03
R6600:Ubr1	UTSW	2	120,745,880 (GRCm39)	missense	probably benign	0.00
R6670:Ubr1	UTSW	2	120,754,611 (GRCm39)	critical splice donor site	probably null
R6731:Ubr1	UTSW	2	120,786,121 (GRCm39)	missense	probably null	0.99
R6836:Ubr1	UTSW	2	120,727,156 (GRCm39)	splice site	probably null
R6994:Ubr1	UTSW	2	120,794,074 (GRCm39)	missense	probably benign
R7121:Ubr1	UTSW	2	120,705,979 (GRCm39)	missense	probably benign	0.00
R7204:Ubr1	UTSW	2	120,734,558 (GRCm39)	missense	possibly damaging	0.49
R7209:Ubr1	UTSW	2	120,693,246 (GRCm39)	missense	probably benign	0.04
R7434:Ubr1	UTSW	2	120,693,161 (GRCm39)	missense	probably benign
R7457:Ubr1	UTSW	2	120,748,309 (GRCm39)	missense	probably benign	0.35
R7464:Ubr1	UTSW	2	120,720,255 (GRCm39)	critical splice donor site	probably null
R7519:Ubr1	UTSW	2	120,705,925 (GRCm39)	missense	possibly damaging	0.63
R7574:Ubr1	UTSW	2	120,703,672 (GRCm39)	missense	possibly damaging	0.93
R8030:Ubr1	UTSW	2	120,764,855 (GRCm39)	missense	probably damaging	0.99
R8085:Ubr1	UTSW	2	120,764,898 (GRCm39)	nonsense	probably null
R8221:Ubr1	UTSW	2	120,791,585 (GRCm39)	missense	probably damaging	0.97
R8241:Ubr1	UTSW	2	120,793,937 (GRCm39)	missense	possibly damaging	0.80
R8291:Ubr1	UTSW	2	120,741,596 (GRCm39)	missense	probably benign
R8293:Ubr1	UTSW	2	120,693,202 (GRCm39)	missense	probably benign	0.38
R8420:Ubr1	UTSW	2	120,701,476 (GRCm39)	missense	probably benign
R8489:Ubr1	UTSW	2	120,711,548 (GRCm39)	missense	probably benign	0.42
R8708:Ubr1	UTSW	2	120,696,964 (GRCm39)	missense	probably benign	0.27
R8856:Ubr1	UTSW	2	120,734,523 (GRCm39)	missense	probably damaging	1.00
R8995:Ubr1	UTSW	2	120,697,034 (GRCm39)	missense	probably damaging	1.00
R9153:Ubr1	UTSW	2	120,756,469 (GRCm39)	missense	probably benign	0.00
R9155:Ubr1	UTSW	2	120,754,615 (GRCm39)	missense	possibly damaging	0.84
R9156:Ubr1	UTSW	2	120,703,603 (GRCm39)	critical splice donor site	probably null
R9194:Ubr1	UTSW	2	120,778,325 (GRCm39)	missense	probably damaging	1.00
R9320:Ubr1	UTSW	2	120,727,000 (GRCm39)	missense	probably benign	0.04
R9401:Ubr1	UTSW	2	120,765,765 (GRCm39)	missense	probably benign	0.06
R9430:Ubr1	UTSW	2	120,734,506 (GRCm39)	missense	possibly damaging	0.59
R9515:Ubr1	UTSW	2	120,703,627 (GRCm39)	missense	probably damaging	1.00
R9623:Ubr1	UTSW	2	120,764,820 (GRCm39)	missense	probably benign	0.06
R9703:Ubr1	UTSW	2	120,732,092 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTTCCATGGTAATTCACTGCATATG -3'
(R):5'- CAAGGCCTGACACTGTTACTG -3'

Sequencing Primer
(F):5'- AAGGGAGTGGGGAAGACC -3'
(R):5'- CCTGACACTGTTACTGAGGCTATG -3'

Posted On

2016-06-15