Incidental Mutation 'R5118:Gm1330'
ID392724
Institutional Source Beutler Lab
Gene Symbol Gm1330
Ensembl Gene ENSMUSG00000063507
Gene Namepredicted gene 1330
SynonymsLOC383753
MMRRC Submission 042706-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R5118 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location148990343-149003251 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 149002986 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000080268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081553] [ENSMUST00000109942]
Predicted Effect probably benign
Transcript: ENSMUST00000081553
SMART Domains Protein: ENSMUSP00000080268
Gene: ENSMUSG00000063507

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:CY 34 162 3e-12 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000109942
AA Change: D89G
SMART Domains Protein: ENSMUSP00000105568
Gene: ENSMUSG00000063507
AA Change: D89G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:CY 34 162 1e-11 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Adamts2 A G 11: 50,781,869 E648G probably damaging Het
Ankrd55 A G 13: 112,355,939 S187G probably benign Het
BC080695 T C 4: 143,571,127 L39P probably damaging Het
C87414 T A 5: 93,637,797 D208V probably benign Het
Cd44 C A 2: 102,865,370 E52D probably damaging Het
Col6a5 T A 9: 105,937,005 I603F unknown Het
Dmxl2 C A 9: 54,460,987 R233L probably damaging Het
Dopey1 T C 9: 86,506,259 F429L probably damaging Het
Epsti1 T G 14: 77,986,682 probably null Het
Erfe G T 1: 91,370,716 probably null Het
Galnt5 A G 2: 58,015,003 D526G probably damaging Het
Gm6181 G A 7: 52,755,616 noncoding transcript Het
Irak2 T A 6: 113,665,811 V68D probably benign Het
Kdm1a A G 4: 136,557,358 probably benign Het
Kidins220 C A 12: 24,992,297 Q198K probably damaging Het
Lgr5 A G 10: 115,452,339 V728A possibly damaging Het
Micall2 G A 5: 139,716,447 T347M probably damaging Het
Mrap2 T C 9: 87,182,703 F166L possibly damaging Het
Msh3 A T 13: 92,309,434 probably benign Het
Mul1 T A 4: 138,439,349 L238Q probably damaging Het
Nuak1 G T 10: 84,374,984 H413Q probably benign Het
Olfr1408 T C 1: 173,130,917 Q100R possibly damaging Het
Pcnt C T 10: 76,412,168 A931T probably damaging Het
Pddc1 A T 7: 141,406,806 probably benign Het
Psmb4 T C 3: 94,884,942 Y223C probably damaging Het
Rbm15b G T 9: 106,886,102 A289E possibly damaging Het
Reg3b T A 6: 78,372,128 V79E probably damaging Het
Rsl1 A G 13: 67,181,981 I164M probably damaging Het
Rtp1 T C 16: 23,431,535 F217L probably benign Het
Sfmbt1 T C 14: 30,790,770 L360P probably damaging Het
Sorbs2 T C 8: 45,795,785 V611A probably damaging Het
Tenm4 T A 7: 96,893,086 D1935E probably damaging Het
Tep1 T C 14: 50,855,587 probably null Het
Tmppe T G 9: 114,405,481 S283A probably benign Het
Tmtc1 A G 6: 148,269,987 probably benign Het
Trp63 T C 16: 25,889,010 I552T unknown Het
Tspan2 C A 3: 102,749,835 D45E probably benign Het
Ubr1 T C 2: 120,882,264 E1396G probably benign Het
Usp17lc A T 7: 103,418,661 T388S probably benign Het
Wdr46 T C 17: 33,948,837 V508A possibly damaging Het
Zcchc11 T A 4: 108,520,292 D966E possibly damaging Het
Zfp462 T A 4: 55,010,667 Y878N probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp954 T A 7: 7,115,715 T277S probably benign Het
Other mutations in Gm1330
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02514:Gm1330 APN 2 148999385 splice site probably benign
IGL02751:Gm1330 APN 2 148990473 splice site probably benign
R4463:Gm1330 UTSW 2 149003144 nonsense probably null
R7657:Gm1330 UTSW 2 148999234 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGACACACTTCAGTACAAAGAATGC -3'
(R):5'- AACTGGCCATCTTTGTGCTG -3'

Sequencing Primer
(F):5'- CTGGAGCCATCTGTTTCA -3'
(R):5'- GTACTTCAGCCATGCAGCC -3'
Posted On2016-06-15