Incidental Mutation 'R0443:Tas2r129'
ID39273
Institutional Source Beutler Lab
Gene Symbol Tas2r129
Ensembl Gene ENSMUSG00000063762
Gene Nametaste receptor, type 2, member 129
SynonymsTas2r29, mt2r60, T2R29, mGR29
MMRRC Submission 038644-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.047) question?
Stock #R0443 (G1)
Quality Score225
Status Validated (trace)
Chromosome6
Chromosomal Location132951102-132952066 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 132951196 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 32 (C32F)
Ref Sequence ENSEMBL: ENSMUSP00000067640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070991]
Predicted Effect probably benign
Transcript: ENSMUST00000070991
AA Change: C32F

PolyPhen 2 Score 0.261 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000067640
Gene: ENSMUSG00000063762
AA Change: C32F

DomainStartEndE-ValueType
Pfam:TAS2R 1 302 2.3e-74 PFAM
Meta Mutation Damage Score 0.3010 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3b G T 5: 25,848,411 R246L probably damaging Het
Adam18 T C 8: 24,629,637 probably null Het
Ankhd1 A G 18: 36,644,599 S1612G possibly damaging Het
Caskin1 C T 17: 24,505,400 A1054V probably damaging Het
Casz1 T C 4: 148,948,911 V1380A possibly damaging Het
Cnot6l T G 5: 96,091,745 probably benign Het
Crat T C 2: 30,403,628 probably benign Het
Ctgf T C 10: 24,595,803 probably benign Het
Cux2 C T 5: 121,887,437 R56H possibly damaging Het
Dst A G 1: 34,294,550 probably null Het
Dync2h1 G T 9: 7,167,244 probably null Het
Epg5 T C 18: 77,955,903 probably benign Het
Ergic3 G A 2: 156,016,787 V278M probably benign Het
Fam20b A T 1: 156,681,453 D396E probably benign Het
Gapvd1 A G 2: 34,704,621 probably benign Het
Golga1 A T 2: 39,018,441 S749T probably damaging Het
Gsdma2 C T 11: 98,657,688 T255I probably damaging Het
Itga1 T A 13: 114,992,460 D554V probably benign Het
Itgam C T 7: 128,081,634 A245V probably damaging Het
Kcnk15 A G 2: 163,858,323 T161A probably benign Het
Map3k19 A T 1: 127,822,415 N1066K probably benign Het
Ms4a6b A G 19: 11,521,680 I53V possibly damaging Het
Mtf1 C T 4: 124,824,282 probably benign Het
Neb T C 2: 52,161,477 probably null Het
Nop9 A G 14: 55,753,748 S621G probably benign Het
Olfr378 A G 11: 73,425,755 V76A probably damaging Het
Olfr459 T A 6: 41,771,895 I135F possibly damaging Het
Olfr484 A G 7: 108,124,816 V149A probably benign Het
Pacs1 A T 19: 5,272,583 Y102* probably null Het
Pcdhb10 A C 18: 37,412,432 D187A probably damaging Het
Pih1d2 A G 9: 50,621,103 R170G possibly damaging Het
Pikfyve A G 1: 65,196,706 H179R probably damaging Het
Pknox1 A G 17: 31,592,219 S156G probably damaging Het
Prkcz T A 4: 155,269,140 D250V probably damaging Het
Psg16 T A 7: 17,095,163 I224N probably benign Het
Slc25a40 T A 5: 8,447,348 S229T probably benign Het
Slc43a2 T C 11: 75,544,667 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tfap2d C T 1: 19,104,367 R15C possibly damaging Het
Tonsl T C 15: 76,639,684 S39G probably benign Het
Trove2 A G 1: 143,765,923 probably benign Het
Trpc2 A G 7: 102,093,520 probably benign Het
Ttc17 A G 2: 94,378,094 F144S probably benign Het
Twnk G T 19: 45,008,139 G337V possibly damaging Het
Uvssa A G 5: 33,388,824 R180G possibly damaging Het
Vmn1r197 T A 13: 22,328,071 I54K possibly damaging Het
Vmn1r71 G A 7: 10,748,311 T84I probably benign Het
Zbtb49 T C 5: 38,200,830 E693G probably benign Het
Other mutations in Tas2r129
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Tas2r129 APN 6 132951394 nonsense probably null
R0389:Tas2r129 UTSW 6 132951196 missense probably benign 0.26
R0487:Tas2r129 UTSW 6 132951943 missense probably benign 0.26
R0487:Tas2r129 UTSW 6 132951944 missense probably benign 0.31
R0576:Tas2r129 UTSW 6 132951534 missense probably benign 0.38
R1253:Tas2r129 UTSW 6 132952036 missense probably benign 0.11
R3124:Tas2r129 UTSW 6 132951448 missense probably damaging 1.00
R4493:Tas2r129 UTSW 6 132951354 missense probably benign 0.31
R4494:Tas2r129 UTSW 6 132951354 missense probably benign 0.31
R4591:Tas2r129 UTSW 6 132951611 missense probably benign 0.10
R6156:Tas2r129 UTSW 6 132951492 missense probably benign 0.31
R6495:Tas2r129 UTSW 6 132951165 missense probably benign 0.00
R7600:Tas2r129 UTSW 6 132951174 nonsense probably null
R7608:Tas2r129 UTSW 6 132951193 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTTCTGCAACACACTAGCTCTGTC -3'
(R):5'- TGCAGCAAGCCACATGCTAAAATG -3'

Sequencing Primer
(F):5'- ACACCACTTGGTCTACAGTGTG -3'
(R):5'- GCCACATGCTAAAATGATTGCTG -3'
Posted On2013-05-23