Incidental Mutation 'R5118:C87414'
ID392732
Institutional Source Beutler Lab
Gene Symbol C87414
Ensembl Gene ENSMUSG00000070686
Gene Nameexpressed sequence C87414
Synonyms
MMRRC Submission 042706-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R5118 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location93634993-93671551 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 93637797 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 208 (D208V)
Ref Sequence ENSEMBL: ENSMUSP00000124780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076321] [ENSMUST00000159578] [ENSMUST00000160382] [ENSMUST00000162964]
Predicted Effect probably benign
Transcript: ENSMUST00000076321
SMART Domains Protein: ENSMUSP00000075662
Gene: ENSMUSG00000070686

DomainStartEndE-ValueType
SCOP:d1a4ya_ 67 191 1e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159578
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159691
Predicted Effect probably benign
Transcript: ENSMUST00000160382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161919
Predicted Effect probably benign
Transcript: ENSMUST00000162964
AA Change: D208V

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000124780
Gene: ENSMUSG00000070686
AA Change: D208V

DomainStartEndE-ValueType
SCOP:d1a4ya_ 199 388 1e-9 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Adamts2 A G 11: 50,781,869 E648G probably damaging Het
Ankrd55 A G 13: 112,355,939 S187G probably benign Het
BC080695 T C 4: 143,571,127 L39P probably damaging Het
Cd44 C A 2: 102,865,370 E52D probably damaging Het
Col6a5 T A 9: 105,937,005 I603F unknown Het
Dmxl2 C A 9: 54,460,987 R233L probably damaging Het
Dopey1 T C 9: 86,506,259 F429L probably damaging Het
Epsti1 T G 14: 77,986,682 probably null Het
Erfe G T 1: 91,370,716 probably null Het
Galnt5 A G 2: 58,015,003 D526G probably damaging Het
Gm1330 T C 2: 149,002,986 probably benign Het
Gm6181 G A 7: 52,755,616 noncoding transcript Het
Irak2 T A 6: 113,665,811 V68D probably benign Het
Kdm1a A G 4: 136,557,358 probably benign Het
Kidins220 C A 12: 24,992,297 Q198K probably damaging Het
Lgr5 A G 10: 115,452,339 V728A possibly damaging Het
Micall2 G A 5: 139,716,447 T347M probably damaging Het
Mrap2 T C 9: 87,182,703 F166L possibly damaging Het
Msh3 A T 13: 92,309,434 probably benign Het
Mul1 T A 4: 138,439,349 L238Q probably damaging Het
Nuak1 G T 10: 84,374,984 H413Q probably benign Het
Olfr1408 T C 1: 173,130,917 Q100R possibly damaging Het
Pcnt C T 10: 76,412,168 A931T probably damaging Het
Pddc1 A T 7: 141,406,806 probably benign Het
Psmb4 T C 3: 94,884,942 Y223C probably damaging Het
Rbm15b G T 9: 106,886,102 A289E possibly damaging Het
Reg3b T A 6: 78,372,128 V79E probably damaging Het
Rsl1 A G 13: 67,181,981 I164M probably damaging Het
Rtp1 T C 16: 23,431,535 F217L probably benign Het
Sfmbt1 T C 14: 30,790,770 L360P probably damaging Het
Sorbs2 T C 8: 45,795,785 V611A probably damaging Het
Tenm4 T A 7: 96,893,086 D1935E probably damaging Het
Tep1 T C 14: 50,855,587 probably null Het
Tmppe T G 9: 114,405,481 S283A probably benign Het
Tmtc1 A G 6: 148,269,987 probably benign Het
Trp63 T C 16: 25,889,010 I552T unknown Het
Tspan2 C A 3: 102,749,835 D45E probably benign Het
Ubr1 T C 2: 120,882,264 E1396G probably benign Het
Usp17lc A T 7: 103,418,661 T388S probably benign Het
Wdr46 T C 17: 33,948,837 V508A possibly damaging Het
Zcchc11 T A 4: 108,520,292 D966E possibly damaging Het
Zfp462 T A 4: 55,010,667 Y878N probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp954 T A 7: 7,115,715 T277S probably benign Het
Other mutations in C87414
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:C87414 APN 5 93636477 missense probably damaging 1.00
IGL01642:C87414 APN 5 93636295 missense possibly damaging 0.84
IGL02735:C87414 APN 5 93638644 missense possibly damaging 0.94
PIT4466001:C87414 UTSW 5 93636288 missense probably damaging 1.00
R1830:C87414 UTSW 5 93637686 missense probably benign 0.03
R2071:C87414 UTSW 5 93636516 missense probably damaging 1.00
R4404:C87414 UTSW 5 93637713 missense possibly damaging 0.81
R4606:C87414 UTSW 5 93636602 missense probably damaging 0.96
R4672:C87414 UTSW 5 93636323 missense probably damaging 0.99
R5056:C87414 UTSW 5 93638925 start gained probably benign
R5288:C87414 UTSW 5 93637748 missense possibly damaging 0.86
R5441:C87414 UTSW 5 93636597 missense possibly damaging 0.84
R6190:C87414 UTSW 5 93638078 missense probably benign 0.14
R6513:C87414 UTSW 5 93637532 unclassified probably null
R7464:C87414 UTSW 5 93636240 missense probably damaging 1.00
R8130:C87414 UTSW 5 93636738 missense probably damaging 1.00
RF006:C87414 UTSW 5 93636703 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ACGTGTTTCATGAAGATATGCTGG -3'
(R):5'- CGTCTGAAGGTCATAGTCAACC -3'

Sequencing Primer
(F):5'- TGGAGACAGTTGAATTGGGAAAACTG -3'
(R):5'- GGTCATAGTCAACCTGTCAATCAG -3'
Posted On2016-06-15