Incidental Mutation 'R5118:Irak2'
ID392735
Institutional Source Beutler Lab
Gene Symbol Irak2
Ensembl Gene ENSMUSG00000060477
Gene Nameinterleukin-1 receptor-associated kinase 2
Synonyms6330415L08Rik, IRAK-2
MMRRC Submission 042706-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5118 (G1)
Quality Score188
Status Validated
Chromosome6
Chromosomal Location113638467-113695026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 113665811 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 68 (V68D)
Ref Sequence ENSEMBL: ENSMUSP00000086417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059286] [ENSMUST00000089022] [ENSMUST00000089023] [ENSMUST00000204744]
Predicted Effect probably benign
Transcript: ENSMUST00000059286
AA Change: V129D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000055073
Gene: ENSMUSG00000060477
AA Change: V129D

DomainStartEndE-ValueType
Pfam:Death 14 94 4.8e-16 PFAM
Pfam:Pkinase 208 473 4.8e-28 PFAM
Pfam:Pkinase_Tyr 208 482 1.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089022
SMART Domains Protein: ENSMUSP00000086416
Gene: ENSMUSG00000060477

DomainStartEndE-ValueType
Pfam:Death 14 93 3.9e-16 PFAM
Pfam:Pkinase 160 425 1.3e-30 PFAM
Pfam:Pkinase_Tyr 160 436 1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089023
AA Change: V68D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000086417
Gene: ENSMUSG00000060477
AA Change: V68D

DomainStartEndE-ValueType
PDB:3MOP|N 2 35 3e-13 PDB
Pfam:Pkinase 147 412 1.2e-30 PFAM
Pfam:Pkinase_Tyr 147 419 9.8e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113024
SMART Domains Protein: ENSMUSP00000108647
Gene: ENSMUSG00000060477

DomainStartEndE-ValueType
Pfam:Pkinase 65 330 1.4e-30 PFAM
Pfam:Pkinase_Tyr 65 342 1.1e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155554
SMART Domains Protein: ENSMUSP00000117755
Gene: ENSMUSG00000060477

DomainStartEndE-ValueType
SCOP:d1b6cb_ 53 96 8e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204091
Predicted Effect probably benign
Transcript: ENSMUST00000204744
SMART Domains Protein: ENSMUSP00000144848
Gene: ENSMUSG00000060477

DomainStartEndE-ValueType
PDB:3MOP|N 2 55 3e-30 PDB
SCOP:d1d2za_ 4 55 9e-13 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IRAK2 encodes the interleukin-1 receptor-associated kinase 2, one of two putative serine/threonine kinases that become associated with the interleukin-1 receptor (IL1R) upon stimulation. IRAK2 is reported to participate in the IL1-induced upregulation of NF-kappaB. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased susceptibility to endotoxin shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Adamts2 A G 11: 50,781,869 E648G probably damaging Het
Ankrd55 A G 13: 112,355,939 S187G probably benign Het
BC080695 T C 4: 143,571,127 L39P probably damaging Het
C87414 T A 5: 93,637,797 D208V probably benign Het
Cd44 C A 2: 102,865,370 E52D probably damaging Het
Col6a5 T A 9: 105,937,005 I603F unknown Het
Dmxl2 C A 9: 54,460,987 R233L probably damaging Het
Dopey1 T C 9: 86,506,259 F429L probably damaging Het
Epsti1 T G 14: 77,986,682 probably null Het
Erfe G T 1: 91,370,716 probably null Het
Galnt5 A G 2: 58,015,003 D526G probably damaging Het
Gm1330 T C 2: 149,002,986 probably benign Het
Gm6181 G A 7: 52,755,616 noncoding transcript Het
Kdm1a A G 4: 136,557,358 probably benign Het
Kidins220 C A 12: 24,992,297 Q198K probably damaging Het
Lgr5 A G 10: 115,452,339 V728A possibly damaging Het
Micall2 G A 5: 139,716,447 T347M probably damaging Het
Mrap2 T C 9: 87,182,703 F166L possibly damaging Het
Msh3 A T 13: 92,309,434 probably benign Het
Mul1 T A 4: 138,439,349 L238Q probably damaging Het
Nuak1 G T 10: 84,374,984 H413Q probably benign Het
Olfr1408 T C 1: 173,130,917 Q100R possibly damaging Het
Pcnt C T 10: 76,412,168 A931T probably damaging Het
Pddc1 A T 7: 141,406,806 probably benign Het
Psmb4 T C 3: 94,884,942 Y223C probably damaging Het
Rbm15b G T 9: 106,886,102 A289E possibly damaging Het
Reg3b T A 6: 78,372,128 V79E probably damaging Het
Rsl1 A G 13: 67,181,981 I164M probably damaging Het
Rtp1 T C 16: 23,431,535 F217L probably benign Het
Sfmbt1 T C 14: 30,790,770 L360P probably damaging Het
Sorbs2 T C 8: 45,795,785 V611A probably damaging Het
Tenm4 T A 7: 96,893,086 D1935E probably damaging Het
Tep1 T C 14: 50,855,587 probably null Het
Tmppe T G 9: 114,405,481 S283A probably benign Het
Tmtc1 A G 6: 148,269,987 probably benign Het
Trp63 T C 16: 25,889,010 I552T unknown Het
Tspan2 C A 3: 102,749,835 D45E probably benign Het
Ubr1 T C 2: 120,882,264 E1396G probably benign Het
Usp17lc A T 7: 103,418,661 T388S probably benign Het
Wdr46 T C 17: 33,948,837 V508A possibly damaging Het
Zcchc11 T A 4: 108,520,292 D966E possibly damaging Het
Zfp462 T A 4: 55,010,667 Y878N probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp954 T A 7: 7,115,715 T277S probably benign Het
Other mutations in Irak2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Irak2 APN 6 113678675 missense probably benign 0.41
IGL03026:Irak2 APN 6 113676651 missense probably damaging 1.00
R0047:Irak2 UTSW 6 113672953 splice site probably benign
R0047:Irak2 UTSW 6 113678738 missense probably benign 0.43
R0658:Irak2 UTSW 6 113638564 missense probably damaging 1.00
R1120:Irak2 UTSW 6 113675759 unclassified probably benign
R2143:Irak2 UTSW 6 113672827 missense probably benign 0.03
R2190:Irak2 UTSW 6 113686943 missense probably damaging 1.00
R2342:Irak2 UTSW 6 113693671 missense probably benign 0.08
R2507:Irak2 UTSW 6 113647678 missense probably damaging 1.00
R3160:Irak2 UTSW 6 113672760 missense probably benign 0.18
R3162:Irak2 UTSW 6 113672760 missense probably benign 0.18
R4231:Irak2 UTSW 6 113690856 missense probably damaging 0.98
R4604:Irak2 UTSW 6 113672887 missense probably damaging 1.00
R4772:Irak2 UTSW 6 113693722 missense probably damaging 1.00
R4940:Irak2 UTSW 6 113693730 missense probably benign 0.41
R5082:Irak2 UTSW 6 113672844 missense probably damaging 1.00
R5194:Irak2 UTSW 6 113690790 missense probably benign 0.00
R5604:Irak2 UTSW 6 113690831 missense possibly damaging 0.91
R5928:Irak2 UTSW 6 113676626 missense probably damaging 1.00
R6479:Irak2 UTSW 6 113686941 missense probably damaging 0.99
R7102:Irak2 UTSW 6 113686849 missense probably damaging 1.00
R7153:Irak2 UTSW 6 113678709 missense probably benign 0.34
R7199:Irak2 UTSW 6 113673084 missense probably damaging 0.99
R7509:Irak2 UTSW 6 113690898 frame shift probably null
R7694:Irak2 UTSW 6 113690898 missense probably damaging 1.00
R7716:Irak2 UTSW 6 113690898 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGTTGGACCTCAAGTCTCTGAC -3'
(R):5'- TGATCCTAGCACCCACATAGTG -3'

Sequencing Primer
(F):5'- GTTCCTGAGAGCACATCT -3'
(R):5'- TAGTGATCCTAGCACCCACATAGTG -3'
Posted On2016-06-15