Incidental Mutation 'R5118:Tmtc1'
ID392736
Institutional Source Beutler Lab
Gene Symbol Tmtc1
Ensembl Gene ENSMUSG00000030306
Gene Nametransmembrane and tetratricopeptide repeat containing 1
Synonyms
MMRRC Submission 042706-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R5118 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location148232430-148444389 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 148269987 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000098335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060095] [ENSMUST00000100772] [ENSMUST00000140797]
Predicted Effect probably benign
Transcript: ENSMUST00000060095
SMART Domains Protein: ENSMUSP00000056353
Gene: ENSMUSG00000030306

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
transmembrane domain 111 130 N/A INTRINSIC
transmembrane domain 142 164 N/A INTRINSIC
low complexity region 170 180 N/A INTRINSIC
transmembrane domain 195 217 N/A INTRINSIC
low complexity region 250 269 N/A INTRINSIC
transmembrane domain 328 350 N/A INTRINSIC
Pfam:DUF1736 351 425 1.3e-33 PFAM
transmembrane domain 444 466 N/A INTRINSIC
transmembrane domain 494 516 N/A INTRINSIC
TPR 543 576 2.42e-3 SMART
TPR 577 607 8.76e-1 SMART
TPR 608 641 1.69e-2 SMART
TPR 642 675 1.28e-2 SMART
TPR 676 709 4.31e0 SMART
TPR 710 743 1.11e-2 SMART
TPR 744 776 4.62e0 SMART
TPR 811 844 1.1e-1 SMART
TPR 849 882 4.45e-2 SMART
TPR 883 916 1.05e-3 SMART
low complexity region 926 941 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100772
SMART Domains Protein: ENSMUSP00000098335
Gene: ENSMUSG00000030306

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
transmembrane domain 111 130 N/A INTRINSIC
transmembrane domain 142 164 N/A INTRINSIC
low complexity region 170 180 N/A INTRINSIC
transmembrane domain 195 217 N/A INTRINSIC
low complexity region 250 269 N/A INTRINSIC
Pfam:DUF1736 349 427 6.9e-35 PFAM
transmembrane domain 444 466 N/A INTRINSIC
transmembrane domain 494 516 N/A INTRINSIC
TPR 539 569 8.76e-1 SMART
TPR 570 603 1.69e-2 SMART
TPR 604 637 1.28e-2 SMART
TPR 638 671 4.31e0 SMART
TPR 672 705 1.11e-2 SMART
TPR 706 738 4.62e0 SMART
TPR 773 806 1.1e-1 SMART
TPR 811 844 4.45e-2 SMART
TPR 845 878 1.05e-3 SMART
low complexity region 888 903 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000140797
AA Change: W555R
SMART Domains Protein: ENSMUSP00000115543
Gene: ENSMUSG00000030306
AA Change: W555R

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
transmembrane domain 112 134 N/A INTRINSIC
low complexity region 160 179 N/A INTRINSIC
Pfam:DUF1736 259 337 9.9e-36 PFAM
transmembrane domain 357 379 N/A INTRINSIC
transmembrane domain 403 425 N/A INTRINSIC
Pfam:TPR_12 449 516 9.6e-10 PFAM
Pfam:TPR_11 451 498 1.3e-9 PFAM
Pfam:TPR_1 453 486 5.7e-6 PFAM
Pfam:TPR_2 453 486 2.6e-7 PFAM
Pfam:TPR_8 453 486 6.5e-4 PFAM
Pfam:TPR_1 487 517 1.6e-3 PFAM
Pfam:TPR_8 496 518 1.5e-3 PFAM
low complexity region 521 539 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Adamts2 A G 11: 50,781,869 E648G probably damaging Het
Ankrd55 A G 13: 112,355,939 S187G probably benign Het
BC080695 T C 4: 143,571,127 L39P probably damaging Het
C87414 T A 5: 93,637,797 D208V probably benign Het
Cd44 C A 2: 102,865,370 E52D probably damaging Het
Col6a5 T A 9: 105,937,005 I603F unknown Het
Dmxl2 C A 9: 54,460,987 R233L probably damaging Het
Dopey1 T C 9: 86,506,259 F429L probably damaging Het
Epsti1 T G 14: 77,986,682 probably null Het
Erfe G T 1: 91,370,716 probably null Het
Galnt5 A G 2: 58,015,003 D526G probably damaging Het
Gm1330 T C 2: 149,002,986 probably benign Het
Gm6181 G A 7: 52,755,616 noncoding transcript Het
Irak2 T A 6: 113,665,811 V68D probably benign Het
Kdm1a A G 4: 136,557,358 probably benign Het
Kidins220 C A 12: 24,992,297 Q198K probably damaging Het
Lgr5 A G 10: 115,452,339 V728A possibly damaging Het
Micall2 G A 5: 139,716,447 T347M probably damaging Het
Mrap2 T C 9: 87,182,703 F166L possibly damaging Het
Msh3 A T 13: 92,309,434 probably benign Het
Mul1 T A 4: 138,439,349 L238Q probably damaging Het
Nuak1 G T 10: 84,374,984 H413Q probably benign Het
Olfr1408 T C 1: 173,130,917 Q100R possibly damaging Het
Pcnt C T 10: 76,412,168 A931T probably damaging Het
Pddc1 A T 7: 141,406,806 probably benign Het
Psmb4 T C 3: 94,884,942 Y223C probably damaging Het
Rbm15b G T 9: 106,886,102 A289E possibly damaging Het
Reg3b T A 6: 78,372,128 V79E probably damaging Het
Rsl1 A G 13: 67,181,981 I164M probably damaging Het
Rtp1 T C 16: 23,431,535 F217L probably benign Het
Sfmbt1 T C 14: 30,790,770 L360P probably damaging Het
Sorbs2 T C 8: 45,795,785 V611A probably damaging Het
Tenm4 T A 7: 96,893,086 D1935E probably damaging Het
Tep1 T C 14: 50,855,587 probably null Het
Tmppe T G 9: 114,405,481 S283A probably benign Het
Trp63 T C 16: 25,889,010 I552T unknown Het
Tspan2 C A 3: 102,749,835 D45E probably benign Het
Ubr1 T C 2: 120,882,264 E1396G probably benign Het
Usp17lc A T 7: 103,418,661 T388S probably benign Het
Wdr46 T C 17: 33,948,837 V508A possibly damaging Het
Zcchc11 T A 4: 108,520,292 D966E possibly damaging Het
Zfp462 T A 4: 55,010,667 Y878N probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp954 T A 7: 7,115,715 T277S probably benign Het
Other mutations in Tmtc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Tmtc1 APN 6 148443944 missense probably benign 0.02
IGL01377:Tmtc1 APN 6 148245787 missense possibly damaging 0.82
IGL01728:Tmtc1 APN 6 148411066 missense probably benign 0.02
IGL02904:Tmtc1 APN 6 148249482 splice site probably benign
R0044:Tmtc1 UTSW 6 148412829 splice site probably benign
R0107:Tmtc1 UTSW 6 148425913 missense possibly damaging 0.85
R0114:Tmtc1 UTSW 6 148412830 splice site probably benign
R0243:Tmtc1 UTSW 6 148246837 missense probably damaging 1.00
R0310:Tmtc1 UTSW 6 148249581 missense probably benign 0.00
R0441:Tmtc1 UTSW 6 148415758 missense probably damaging 1.00
R0491:Tmtc1 UTSW 6 148412640 critical splice donor site probably null
R0578:Tmtc1 UTSW 6 148355218 intron probably benign
R0685:Tmtc1 UTSW 6 148411240 missense probably benign 0.39
R1470:Tmtc1 UTSW 6 148305985 splice site probably benign
R1533:Tmtc1 UTSW 6 148245710 critical splice donor site probably null
R1577:Tmtc1 UTSW 6 148412820 critical splice acceptor site probably null
R1617:Tmtc1 UTSW 6 148355404 intron probably benign
R1763:Tmtc1 UTSW 6 148294618 missense probably damaging 1.00
R1909:Tmtc1 UTSW 6 148444048 missense possibly damaging 0.93
R1943:Tmtc1 UTSW 6 148425918 nonsense probably null
R2050:Tmtc1 UTSW 6 148262883 missense probably damaging 1.00
R2305:Tmtc1 UTSW 6 148244697 missense probably damaging 0.99
R3813:Tmtc1 UTSW 6 148354891 intron probably benign
R4355:Tmtc1 UTSW 6 148355098 intron probably benign
R4537:Tmtc1 UTSW 6 148262782 critical splice donor site probably null
R4731:Tmtc1 UTSW 6 148284980 splice site probably null
R4732:Tmtc1 UTSW 6 148284980 splice site probably null
R4733:Tmtc1 UTSW 6 148284980 splice site probably null
R4960:Tmtc1 UTSW 6 148443947 unclassified probably benign
R5048:Tmtc1 UTSW 6 148237846 missense possibly damaging 0.96
R5279:Tmtc1 UTSW 6 148355131 intron probably benign
R5310:Tmtc1 UTSW 6 148355412 intron probably benign
R5411:Tmtc1 UTSW 6 148443899 critical splice donor site probably null
R5646:Tmtc1 UTSW 6 148246831 missense probably damaging 1.00
R5868:Tmtc1 UTSW 6 148237855 missense probably damaging 1.00
R6482:Tmtc1 UTSW 6 148412745 missense probably benign 0.00
R7162:Tmtc1 UTSW 6 148271487 missense probably damaging 1.00
R7462:Tmtc1 UTSW 6 148325145 missense probably damaging 1.00
R7702:Tmtc1 UTSW 6 148443917 missense probably benign 0.35
R8304:Tmtc1 UTSW 6 148271385 missense probably damaging 0.99
RF018:Tmtc1 UTSW 6 148247511 missense probably damaging 1.00
Z1177:Tmtc1 UTSW 6 148411080 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- GAGTTCAATCCTGGGTTGATGAC -3'
(R):5'- CAGCAGTTCCCCAGATTAACAG -3'

Sequencing Primer
(F):5'- CTAGGTTAGGGTCACAGAGCTCTAC -3'
(R):5'- GTTCCCCAGATTAACAGTCCAG -3'
Posted On2016-06-15