Incidental Mutation 'R5118:Zfp954'
ID392737
Institutional Source Beutler Lab
Gene Symbol Zfp954
Ensembl Gene ENSMUSG00000062116
Gene Namezinc finger protein 954
Synonyms5730403M16Rik
MMRRC Submission 042706-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5118 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location7114690-7121488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 7115715 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 277 (T277S)
Ref Sequence ENSEMBL: ENSMUSP00000072585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056246]
Predicted Effect probably benign
Transcript: ENSMUST00000056246
AA Change: T277S

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000072585
Gene: ENSMUSG00000062116
AA Change: T277S

DomainStartEndE-ValueType
KRAB 42 102 4.6e-14 SMART
ZnF_C2H2 198 220 5.14e-3 SMART
ZnF_C2H2 226 248 3.21e-4 SMART
ZnF_C2H2 254 276 3.63e-3 SMART
ZnF_C2H2 282 304 7.9e-4 SMART
ZnF_C2H2 310 332 1.69e-3 SMART
ZnF_C2H2 338 360 1.26e-2 SMART
ZnF_C2H2 364 386 2.01e-5 SMART
ZnF_C2H2 392 414 1.26e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210142
Meta Mutation Damage Score 0.2721 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Adamts2 A G 11: 50,781,869 E648G probably damaging Het
Ankrd55 A G 13: 112,355,939 S187G probably benign Het
BC080695 T C 4: 143,571,127 L39P probably damaging Het
C87414 T A 5: 93,637,797 D208V probably benign Het
Cd44 C A 2: 102,865,370 E52D probably damaging Het
Col6a5 T A 9: 105,937,005 I603F unknown Het
Dmxl2 C A 9: 54,460,987 R233L probably damaging Het
Dopey1 T C 9: 86,506,259 F429L probably damaging Het
Epsti1 T G 14: 77,986,682 probably null Het
Erfe G T 1: 91,370,716 probably null Het
Galnt5 A G 2: 58,015,003 D526G probably damaging Het
Gm1330 T C 2: 149,002,986 probably benign Het
Gm6181 G A 7: 52,755,616 noncoding transcript Het
Irak2 T A 6: 113,665,811 V68D probably benign Het
Kdm1a A G 4: 136,557,358 probably benign Het
Kidins220 C A 12: 24,992,297 Q198K probably damaging Het
Lgr5 A G 10: 115,452,339 V728A possibly damaging Het
Micall2 G A 5: 139,716,447 T347M probably damaging Het
Mrap2 T C 9: 87,182,703 F166L possibly damaging Het
Msh3 A T 13: 92,309,434 probably benign Het
Mul1 T A 4: 138,439,349 L238Q probably damaging Het
Nuak1 G T 10: 84,374,984 H413Q probably benign Het
Olfr1408 T C 1: 173,130,917 Q100R possibly damaging Het
Pcnt C T 10: 76,412,168 A931T probably damaging Het
Pddc1 A T 7: 141,406,806 probably benign Het
Psmb4 T C 3: 94,884,942 Y223C probably damaging Het
Rbm15b G T 9: 106,886,102 A289E possibly damaging Het
Reg3b T A 6: 78,372,128 V79E probably damaging Het
Rsl1 A G 13: 67,181,981 I164M probably damaging Het
Rtp1 T C 16: 23,431,535 F217L probably benign Het
Sfmbt1 T C 14: 30,790,770 L360P probably damaging Het
Sorbs2 T C 8: 45,795,785 V611A probably damaging Het
Tenm4 T A 7: 96,893,086 D1935E probably damaging Het
Tep1 T C 14: 50,855,587 probably null Het
Tmppe T G 9: 114,405,481 S283A probably benign Het
Tmtc1 A G 6: 148,269,987 probably benign Het
Trp63 T C 16: 25,889,010 I552T unknown Het
Tspan2 C A 3: 102,749,835 D45E probably benign Het
Ubr1 T C 2: 120,882,264 E1396G probably benign Het
Usp17lc A T 7: 103,418,661 T388S probably benign Het
Wdr46 T C 17: 33,948,837 V508A possibly damaging Het
Zcchc11 T A 4: 108,520,292 D966E possibly damaging Het
Zfp462 T A 4: 55,010,667 Y878N probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Zfp954
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Zfp954 APN 7 7115367 missense probably benign 0.01
IGL01696:Zfp954 APN 7 7115398 missense probably damaging 1.00
R0196:Zfp954 UTSW 7 7115391 missense probably damaging 1.00
R1723:Zfp954 UTSW 7 7115838 missense probably benign 0.04
R2112:Zfp954 UTSW 7 7115610 missense probably damaging 1.00
R2255:Zfp954 UTSW 7 7115322 missense possibly damaging 0.84
R2410:Zfp954 UTSW 7 7117809 missense probably benign 0.03
R5191:Zfp954 UTSW 7 7116023 missense probably damaging 0.96
R5832:Zfp954 UTSW 7 7115390 missense probably damaging 0.97
R5851:Zfp954 UTSW 7 7115625 nonsense probably null
R7633:Zfp954 UTSW 7 7115824 missense possibly damaging 0.72
R7646:Zfp954 UTSW 7 7115721 missense possibly damaging 0.65
R7710:Zfp954 UTSW 7 7117890 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCGGAGTTCTGGGTGAAATAC -3'
(R):5'- GTATATCCCACCTCAATCGGC -3'

Sequencing Primer
(F):5'- GTTCTGGGTGAAATACATGCCAC -3'
(R):5'- TCGGCACTGGAAGATACACACTG -3'
Posted On2016-06-15