Incidental Mutation 'R5118:Usp17lc'
ID392741
Institutional Source Beutler Lab
Gene Symbol Usp17lc
Ensembl Gene ENSMUSG00000058976
Gene Nameubiquitin specific peptidase 17-like C
SynonymsDub2, Usp17l5, Dub2b, Dub-2
MMRRC Submission 042706-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5118 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103415072-103419880 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103418661 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 388 (T388S)
Ref Sequence ENSEMBL: ENSMUSP00000102505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079348] [ENSMUST00000106892]
Predicted Effect probably benign
Transcript: ENSMUST00000079348
AA Change: T388S

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000078323
Gene: ENSMUSG00000058976
AA Change: T388S

DomainStartEndE-ValueType
Pfam:UCH 50 345 3.8e-54 PFAM
Pfam:UCH_1 51 327 3.5e-25 PFAM
low complexity region 374 385 N/A INTRINSIC
low complexity region 529 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106892
AA Change: T388S

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000102505
Gene: ENSMUSG00000058976
AA Change: T388S

DomainStartEndE-ValueType
Pfam:UCH 50 345 1.3e-60 PFAM
Pfam:UCH_1 51 327 5.5e-30 PFAM
low complexity region 374 385 N/A INTRINSIC
low complexity region 529 539 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116717
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 96% (52/54)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic elthality before implantation, failure to hatch from the zona pellucida, decreased cell proliferation and increased apoptosis. Mice heterozygous for this allele exhibit abnormal body, testis and thymus weight and reduced sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Adamts2 A G 11: 50,781,869 E648G probably damaging Het
Ankrd55 A G 13: 112,355,939 S187G probably benign Het
BC080695 T C 4: 143,571,127 L39P probably damaging Het
C87414 T A 5: 93,637,797 D208V probably benign Het
Cd44 C A 2: 102,865,370 E52D probably damaging Het
Col6a5 T A 9: 105,937,005 I603F unknown Het
Dmxl2 C A 9: 54,460,987 R233L probably damaging Het
Dopey1 T C 9: 86,506,259 F429L probably damaging Het
Epsti1 T G 14: 77,986,682 probably null Het
Erfe G T 1: 91,370,716 probably null Het
Galnt5 A G 2: 58,015,003 D526G probably damaging Het
Gm1330 T C 2: 149,002,986 probably benign Het
Gm6181 G A 7: 52,755,616 noncoding transcript Het
Irak2 T A 6: 113,665,811 V68D probably benign Het
Kdm1a A G 4: 136,557,358 probably benign Het
Kidins220 C A 12: 24,992,297 Q198K probably damaging Het
Lgr5 A G 10: 115,452,339 V728A possibly damaging Het
Micall2 G A 5: 139,716,447 T347M probably damaging Het
Mrap2 T C 9: 87,182,703 F166L possibly damaging Het
Msh3 A T 13: 92,309,434 probably benign Het
Mul1 T A 4: 138,439,349 L238Q probably damaging Het
Nuak1 G T 10: 84,374,984 H413Q probably benign Het
Olfr1408 T C 1: 173,130,917 Q100R possibly damaging Het
Pcnt C T 10: 76,412,168 A931T probably damaging Het
Pddc1 A T 7: 141,406,806 probably benign Het
Psmb4 T C 3: 94,884,942 Y223C probably damaging Het
Rbm15b G T 9: 106,886,102 A289E possibly damaging Het
Reg3b T A 6: 78,372,128 V79E probably damaging Het
Rsl1 A G 13: 67,181,981 I164M probably damaging Het
Rtp1 T C 16: 23,431,535 F217L probably benign Het
Sfmbt1 T C 14: 30,790,770 L360P probably damaging Het
Sorbs2 T C 8: 45,795,785 V611A probably damaging Het
Tenm4 T A 7: 96,893,086 D1935E probably damaging Het
Tep1 T C 14: 50,855,587 probably null Het
Tmppe T G 9: 114,405,481 S283A probably benign Het
Tmtc1 A G 6: 148,269,987 probably benign Het
Trp63 T C 16: 25,889,010 I552T unknown Het
Tspan2 C A 3: 102,749,835 D45E probably benign Het
Ubr1 T C 2: 120,882,264 E1396G probably benign Het
Wdr46 T C 17: 33,948,837 V508A possibly damaging Het
Zcchc11 T A 4: 108,520,292 D966E possibly damaging Het
Zfp462 T A 4: 55,010,667 Y878N probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp954 T A 7: 7,115,715 T277S probably benign Het
Other mutations in Usp17lc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Usp17lc APN 7 103418941 missense possibly damaging 0.74
IGL00499:Usp17lc APN 7 103418466 missense probably damaging 1.00
IGL00499:Usp17lc APN 7 103418465 missense probably damaging 1.00
IGL01446:Usp17lc APN 7 103418444 missense probably benign 0.00
R1466:Usp17lc UTSW 7 103418941 missense possibly damaging 0.74
R1466:Usp17lc UTSW 7 103418941 missense possibly damaging 0.74
R1584:Usp17lc UTSW 7 103418941 missense possibly damaging 0.74
R1754:Usp17lc UTSW 7 103418848 missense probably benign 0.01
R2987:Usp17lc UTSW 7 103418302 missense probably damaging 0.99
R3969:Usp17lc UTSW 7 103418419 missense probably damaging 1.00
R4661:Usp17lc UTSW 7 103418590 missense probably benign 0.00
R5413:Usp17lc UTSW 7 103418556 missense probably benign
R6962:Usp17lc UTSW 7 103418911 missense probably benign 0.00
R7412:Usp17lc UTSW 7 103418368 missense probably damaging 1.00
R7638:Usp17lc UTSW 7 103418499 missense probably damaging 1.00
R7748:Usp17lc UTSW 7 103418481 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGATGTGACTTCTGTCCTG -3'
(R):5'- GGCAGATCAAGTTCACCTTCC -3'

Sequencing Primer
(F):5'- GACTTCTGTCCTGAATGAGAATGCC -3'
(R):5'- CCTGAGGCAAGATTTCATTGATCCTG -3'
Posted On2016-06-15