Incidental Mutation 'R5118:Dopey1'
ID392746
Institutional Source Beutler Lab
Gene Symbol Dopey1
Ensembl Gene ENSMUSG00000034973
Gene Namedopey family member 1
SynonymsB130005I07Rik, D9Ertd809e
MMRRC Submission 042706-MU
Accession Numbers

Genbank: NM_177208; MGI: 1289294

Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R5118 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location86467154-86555923 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86506259 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 429 (F429L)
Ref Sequence ENSEMBL: ENSMUSP00000139413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034987] [ENSMUST00000185919] [ENSMUST00000188675] [ENSMUST00000190957]
Predicted Effect probably damaging
Transcript: ENSMUST00000034987
AA Change: F429L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034987
Gene: ENSMUSG00000034973
AA Change: F429L

DomainStartEndE-ValueType
Pfam:Dopey_N 11 300 1e-117 PFAM
low complexity region 631 649 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 1073 1084 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
low complexity region 1268 1281 N/A INTRINSIC
low complexity region 1296 1318 N/A INTRINSIC
low complexity region 1335 1344 N/A INTRINSIC
low complexity region 1362 1373 N/A INTRINSIC
low complexity region 1575 1589 N/A INTRINSIC
low complexity region 2217 2227 N/A INTRINSIC
low complexity region 2351 2362 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185840
Predicted Effect probably damaging
Transcript: ENSMUST00000185919
AA Change: F420L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140040
Gene: ENSMUSG00000034973
AA Change: F420L

DomainStartEndE-ValueType
Pfam:Dopey_N 10 306 1.9e-106 PFAM
low complexity region 629 647 N/A INTRINSIC
low complexity region 959 971 N/A INTRINSIC
low complexity region 1071 1082 N/A INTRINSIC
low complexity region 1103 1116 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
low complexity region 1294 1316 N/A INTRINSIC
low complexity region 1333 1342 N/A INTRINSIC
low complexity region 1360 1371 N/A INTRINSIC
low complexity region 1573 1587 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187607
Predicted Effect probably damaging
Transcript: ENSMUST00000188675
AA Change: F429L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139413
Gene: ENSMUSG00000034973
AA Change: F429L

DomainStartEndE-ValueType
Pfam:Dopey_N 10 306 3e-106 PFAM
low complexity region 622 640 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190906
Predicted Effect probably damaging
Transcript: ENSMUST00000190957
AA Change: F429L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140740
Gene: ENSMUSG00000034973
AA Change: F429L

DomainStartEndE-ValueType
Pfam:Dopey_N 10 305 1.3e-108 PFAM
low complexity region 631 649 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 1073 1084 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
low complexity region 1268 1281 N/A INTRINSIC
low complexity region 1296 1318 N/A INTRINSIC
low complexity region 1335 1344 N/A INTRINSIC
low complexity region 1362 1373 N/A INTRINSIC
low complexity region 1575 1589 N/A INTRINSIC
low complexity region 2217 2227 N/A INTRINSIC
low complexity region 2351 2362 N/A INTRINSIC
Meta Mutation Damage Score 0.0794 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Adamts2 A G 11: 50,781,869 E648G probably damaging Het
Ankrd55 A G 13: 112,355,939 S187G probably benign Het
BC080695 T C 4: 143,571,127 L39P probably damaging Het
C87414 T A 5: 93,637,797 D208V probably benign Het
Cd44 C A 2: 102,865,370 E52D probably damaging Het
Col6a5 T A 9: 105,937,005 I603F unknown Het
Dmxl2 C A 9: 54,460,987 R233L probably damaging Het
Epsti1 T G 14: 77,986,682 probably null Het
Erfe G T 1: 91,370,716 probably null Het
Galnt5 A G 2: 58,015,003 D526G probably damaging Het
Gm1330 T C 2: 149,002,986 probably benign Het
Gm6181 G A 7: 52,755,616 noncoding transcript Het
Irak2 T A 6: 113,665,811 V68D probably benign Het
Kdm1a A G 4: 136,557,358 probably benign Het
Kidins220 C A 12: 24,992,297 Q198K probably damaging Het
Lgr5 A G 10: 115,452,339 V728A possibly damaging Het
Micall2 G A 5: 139,716,447 T347M probably damaging Het
Mrap2 T C 9: 87,182,703 F166L possibly damaging Het
Msh3 A T 13: 92,309,434 probably benign Het
Mul1 T A 4: 138,439,349 L238Q probably damaging Het
Nuak1 G T 10: 84,374,984 H413Q probably benign Het
Olfr1408 T C 1: 173,130,917 Q100R possibly damaging Het
Pcnt C T 10: 76,412,168 A931T probably damaging Het
Pddc1 A T 7: 141,406,806 probably benign Het
Psmb4 T C 3: 94,884,942 Y223C probably damaging Het
Rbm15b G T 9: 106,886,102 A289E possibly damaging Het
Reg3b T A 6: 78,372,128 V79E probably damaging Het
Rsl1 A G 13: 67,181,981 I164M probably damaging Het
Rtp1 T C 16: 23,431,535 F217L probably benign Het
Sfmbt1 T C 14: 30,790,770 L360P probably damaging Het
Sorbs2 T C 8: 45,795,785 V611A probably damaging Het
Tenm4 T A 7: 96,893,086 D1935E probably damaging Het
Tep1 T C 14: 50,855,587 probably null Het
Tmppe T G 9: 114,405,481 S283A probably benign Het
Tmtc1 A G 6: 148,269,987 probably benign Het
Trp63 T C 16: 25,889,010 I552T unknown Het
Tspan2 C A 3: 102,749,835 D45E probably benign Het
Ubr1 T C 2: 120,882,264 E1396G probably benign Het
Usp17lc A T 7: 103,418,661 T388S probably benign Het
Wdr46 T C 17: 33,948,837 V508A possibly damaging Het
Zcchc11 T A 4: 108,520,292 D966E possibly damaging Het
Zfp462 T A 4: 55,010,667 Y878N probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp954 T A 7: 7,115,715 T277S probably benign Het
Other mutations in Dopey1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Dopey1 APN 9 86551679 missense possibly damaging 0.57
IGL00427:Dopey1 APN 9 86521500 missense probably benign 0.09
IGL00427:Dopey1 APN 9 86521498 missense possibly damaging 0.93
IGL00427:Dopey1 APN 9 86521499 missense probably damaging 0.96
IGL00577:Dopey1 APN 9 86520946 missense probably damaging 1.00
IGL00741:Dopey1 APN 9 86522806 missense possibly damaging 0.50
IGL00959:Dopey1 APN 9 86487431 missense probably damaging 1.00
IGL01339:Dopey1 APN 9 86551677 missense possibly damaging 0.90
IGL01608:Dopey1 APN 9 86507561 missense probably benign 0.23
IGL01760:Dopey1 APN 9 86519923 missense probably benign
IGL01788:Dopey1 APN 9 86531719 missense probably benign 0.03
IGL01844:Dopey1 APN 9 86514085 missense probably damaging 1.00
IGL01923:Dopey1 APN 9 86522867 missense probably damaging 1.00
IGL02036:Dopey1 APN 9 86531765 missense probably benign 0.18
IGL02308:Dopey1 APN 9 86520088 missense probably damaging 0.98
IGL02494:Dopey1 APN 9 86526818 missense probably damaging 1.00
IGL02698:Dopey1 APN 9 86524359 splice site probably benign
IGL02731:Dopey1 APN 9 86487381 missense probably damaging 1.00
IGL02821:Dopey1 APN 9 86520156 missense probably benign
IGL02952:Dopey1 APN 9 86532922 splice site probably benign
IGL03071:Dopey1 APN 9 86489615 missense possibly damaging 0.91
IGL03271:Dopey1 APN 9 86504222 nonsense probably null
IGL03344:Dopey1 APN 9 86536144 missense probably damaging 1.00
Beg UTSW 9 86548172 nonsense probably null
groak UTSW 9 86521657 missense probably damaging 1.00
R0055:Dopey1 UTSW 9 86512652 missense probably benign 0.08
R0285:Dopey1 UTSW 9 86512639 missense probably damaging 1.00
R0415:Dopey1 UTSW 9 86506502 missense probably damaging 1.00
R0427:Dopey1 UTSW 9 86507532 missense probably damaging 1.00
R0514:Dopey1 UTSW 9 86520734 missense probably damaging 1.00
R0538:Dopey1 UTSW 9 86485497 missense probably damaging 1.00
R1118:Dopey1 UTSW 9 86515406 missense probably damaging 1.00
R1158:Dopey1 UTSW 9 86485556 missense probably damaging 1.00
R1272:Dopey1 UTSW 9 86521424 missense probably damaging 1.00
R1448:Dopey1 UTSW 9 86542732 splice site probably null
R1584:Dopey1 UTSW 9 86548172 nonsense probably null
R1601:Dopey1 UTSW 9 86536250 missense probably damaging 0.99
R1674:Dopey1 UTSW 9 86536160 missense probably damaging 0.98
R1706:Dopey1 UTSW 9 86554080 missense possibly damaging 0.92
R1856:Dopey1 UTSW 9 86492004 missense probably damaging 0.99
R1926:Dopey1 UTSW 9 86523019 missense probably damaging 1.00
R1929:Dopey1 UTSW 9 86494418 missense probably damaging 1.00
R2029:Dopey1 UTSW 9 86521365 missense probably damaging 1.00
R2125:Dopey1 UTSW 9 86521046 missense probably damaging 1.00
R2206:Dopey1 UTSW 9 86521599 missense probably benign 0.00
R2271:Dopey1 UTSW 9 86494418 missense probably damaging 1.00
R2312:Dopey1 UTSW 9 86521442 nonsense probably null
R2379:Dopey1 UTSW 9 86521085 missense probably damaging 1.00
R2507:Dopey1 UTSW 9 86513117 missense probably damaging 1.00
R3737:Dopey1 UTSW 9 86494433 missense probably damaging 1.00
R3804:Dopey1 UTSW 9 86520995 missense probably damaging 1.00
R3916:Dopey1 UTSW 9 86521133 missense probably damaging 1.00
R3921:Dopey1 UTSW 9 86520271 missense probably benign 0.06
R4035:Dopey1 UTSW 9 86494433 missense probably damaging 1.00
R4392:Dopey1 UTSW 9 86503143 intron probably benign
R4404:Dopey1 UTSW 9 86522813 nonsense probably null
R4513:Dopey1 UTSW 9 86520559 missense probably benign 0.39
R4624:Dopey1 UTSW 9 86521525 missense probably damaging 1.00
R4659:Dopey1 UTSW 9 86502032 intron probably benign
R4910:Dopey1 UTSW 9 86492061 missense probably damaging 1.00
R4919:Dopey1 UTSW 9 86520056 missense possibly damaging 0.47
R5061:Dopey1 UTSW 9 86503108 splice site probably benign
R5079:Dopey1 UTSW 9 86487421 missense probably damaging 1.00
R5169:Dopey1 UTSW 9 86533021 missense probably damaging 1.00
R5176:Dopey1 UTSW 9 86521815 missense probably damaging 1.00
R5190:Dopey1 UTSW 9 86487304 missense probably damaging 1.00
R5256:Dopey1 UTSW 9 86515328 missense probably damaging 1.00
R5346:Dopey1 UTSW 9 86520782 missense probably damaging 1.00
R5484:Dopey1 UTSW 9 86545288 missense probably damaging 1.00
R5501:Dopey1 UTSW 9 86507730 missense probably benign 0.04
R5554:Dopey1 UTSW 9 86521657 missense probably damaging 1.00
R5707:Dopey1 UTSW 9 86502997 missense possibly damaging 0.95
R5826:Dopey1 UTSW 9 86507570 missense possibly damaging 0.94
R5921:Dopey1 UTSW 9 86501922 missense probably damaging 1.00
R5934:Dopey1 UTSW 9 86542442 nonsense probably null
R5936:Dopey1 UTSW 9 86536512 nonsense probably null
R6046:Dopey1 UTSW 9 86515343 missense probably damaging 1.00
R6053:Dopey1 UTSW 9 86515294 missense possibly damaging 0.95
R6072:Dopey1 UTSW 9 86507697 missense probably benign 0.00
R6104:Dopey1 UTSW 9 86520807 missense possibly damaging 0.86
R6125:Dopey1 UTSW 9 86521133 missense probably damaging 1.00
R6299:Dopey1 UTSW 9 86504212 missense probably damaging 1.00
R6930:Dopey1 UTSW 9 86531772 critical splice donor site probably null
R6949:Dopey1 UTSW 9 86500860 missense probably damaging 1.00
R6979:Dopey1 UTSW 9 86521642 missense possibly damaging 0.77
R7035:Dopey1 UTSW 9 86524302 missense possibly damaging 0.85
R7069:Dopey1 UTSW 9 86550169 critical splice donor site probably null
R7101:Dopey1 UTSW 9 86507669 missense probably benign
R7202:Dopey1 UTSW 9 86504167 splice site probably null
R7222:Dopey1 UTSW 9 86522876 critical splice donor site probably null
R7233:Dopey1 UTSW 9 86521696 missense probably benign 0.00
R7236:Dopey1 UTSW 9 86515378 missense probably damaging 1.00
R7252:Dopey1 UTSW 9 86500821 missense probably damaging 1.00
R7268:Dopey1 UTSW 9 86512777 nonsense probably null
R7353:Dopey1 UTSW 9 86512859 missense probably damaging 0.99
R7481:Dopey1 UTSW 9 86535932 missense probably damaging 1.00
R7498:Dopey1 UTSW 9 86494411 missense possibly damaging 0.95
R7507:Dopey1 UTSW 9 86535949 missense probably benign 0.01
R7525:Dopey1 UTSW 9 86506290 missense probably damaging 1.00
R7539:Dopey1 UTSW 9 86521573 missense probably benign 0.03
R7751:Dopey1 UTSW 9 86507730 missense probably benign 0.00
R7753:Dopey1 UTSW 9 86489702 missense possibly damaging 0.52
R7839:Dopey1 UTSW 9 86542765 nonsense probably null
R7868:Dopey1 UTSW 9 86501984 critical splice donor site probably null
R8061:Dopey1 UTSW 9 86521193 missense possibly damaging 0.95
R8067:Dopey1 UTSW 9 86518339 missense probably benign 0.00
R8156:Dopey1 UTSW 9 86494457 missense probably damaging 1.00
R8196:Dopey1 UTSW 9 86523098 missense probably benign 0.12
R8223:Dopey1 UTSW 9 86518292 missense probably damaging 1.00
R8267:Dopey1 UTSW 9 86514001 missense possibly damaging 0.81
R8276:Dopey1 UTSW 9 86517039 missense probably benign
R8306:Dopey1 UTSW 9 86520206 missense possibly damaging 0.94
RF004:Dopey1 UTSW 9 86554191 missense probably benign
X0019:Dopey1 UTSW 9 86506227 missense probably damaging 1.00
X0019:Dopey1 UTSW 9 86531750 missense probably damaging 0.98
ZE80:Dopey1 UTSW 9 86500842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTACCTCCAATCAGGCAGTG -3'
(R):5'- AGTTGTAACTCAGACGAATCACTAC -3'

Sequencing Primer
(F):5'- TCCAATCAGGCAGTGTTCTAGCAG -3'
(R):5'- GACGAATCACTACTGTCTCCAGGTC -3'
Posted On2016-06-15