Incidental Mutation 'R5118:Rbm15b'
ID392749
Institutional Source Beutler Lab
Gene Symbol Rbm15b
Ensembl Gene ENSMUSG00000074102
Gene NameRNA binding motif protein 15B
Synonyms
MMRRC Submission 042706-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.511) question?
Stock #R5118 (G1)
Quality Score139
Status Validated
Chromosome9
Chromosomal Location106880918-106887428 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 106886102 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 289 (A289E)
Ref Sequence ENSEMBL: ENSMUSP00000059330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055843] [ENSMUST00000069036] [ENSMUST00000159283]
PDB Structure
Solution structure of the RNA recognition motif from hypothetical RNA binding protein BC052180 [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055843
AA Change: A289E

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000059330
Gene: ENSMUSG00000074102
AA Change: A289E

DomainStartEndE-ValueType
low complexity region 5 41 N/A INTRINSIC
low complexity region 53 75 N/A INTRINSIC
low complexity region 78 133 N/A INTRINSIC
RRM 137 212 2.47e-2 SMART
low complexity region 216 251 N/A INTRINSIC
low complexity region 266 299 N/A INTRINSIC
RRM 334 406 2.03e-15 SMART
RRM 415 484 3.57e-11 SMART
low complexity region 653 675 N/A INTRINSIC
Pfam:SPOC 719 854 1.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069036
SMART Domains Protein: ENSMUSP00000066534
Gene: ENSMUSG00000032575

DomainStartEndE-ValueType
Pfam:Armet 13 165 3.2e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159283
SMART Domains Protein: ENSMUSP00000124562
Gene: ENSMUSG00000032575

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Armet 26 171 9.1e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159620
SMART Domains Protein: ENSMUSP00000123907
Gene: ENSMUSG00000032575

DomainStartEndE-ValueType
Pfam:Armet 18 120 1.7e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160503
SMART Domains Protein: ENSMUSP00000124453
Gene: ENSMUSG00000032575

DomainStartEndE-ValueType
Pfam:Armet 17 118 1.6e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160978
SMART Domains Protein: ENSMUSP00000124791
Gene: ENSMUSG00000032575

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Armet 26 124 1.6e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161272
SMART Domains Protein: ENSMUSP00000125424
Gene: ENSMUSG00000032575

DomainStartEndE-ValueType
Pfam:Armet 1 51 2.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162801
Predicted Effect probably benign
Transcript: ENSMUST00000185707
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the SPEN (Split-end) family of proteins, including RBM15B, have repressor function in several signaling pathways and may bind to RNA through interaction with spliceosome components (Hiriart et al., 2005 [PubMed 16129689]).[supplied by OMIM, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Adamts2 A G 11: 50,781,869 E648G probably damaging Het
Ankrd55 A G 13: 112,355,939 S187G probably benign Het
BC080695 T C 4: 143,571,127 L39P probably damaging Het
C87414 T A 5: 93,637,797 D208V probably benign Het
Cd44 C A 2: 102,865,370 E52D probably damaging Het
Col6a5 T A 9: 105,937,005 I603F unknown Het
Dmxl2 C A 9: 54,460,987 R233L probably damaging Het
Dopey1 T C 9: 86,506,259 F429L probably damaging Het
Epsti1 T G 14: 77,986,682 probably null Het
Erfe G T 1: 91,370,716 probably null Het
Galnt5 A G 2: 58,015,003 D526G probably damaging Het
Gm1330 T C 2: 149,002,986 probably benign Het
Gm6181 G A 7: 52,755,616 noncoding transcript Het
Irak2 T A 6: 113,665,811 V68D probably benign Het
Kdm1a A G 4: 136,557,358 probably benign Het
Kidins220 C A 12: 24,992,297 Q198K probably damaging Het
Lgr5 A G 10: 115,452,339 V728A possibly damaging Het
Micall2 G A 5: 139,716,447 T347M probably damaging Het
Mrap2 T C 9: 87,182,703 F166L possibly damaging Het
Msh3 A T 13: 92,309,434 probably benign Het
Mul1 T A 4: 138,439,349 L238Q probably damaging Het
Nuak1 G T 10: 84,374,984 H413Q probably benign Het
Olfr1408 T C 1: 173,130,917 Q100R possibly damaging Het
Pcnt C T 10: 76,412,168 A931T probably damaging Het
Pddc1 A T 7: 141,406,806 probably benign Het
Psmb4 T C 3: 94,884,942 Y223C probably damaging Het
Reg3b T A 6: 78,372,128 V79E probably damaging Het
Rsl1 A G 13: 67,181,981 I164M probably damaging Het
Rtp1 T C 16: 23,431,535 F217L probably benign Het
Sfmbt1 T C 14: 30,790,770 L360P probably damaging Het
Sorbs2 T C 8: 45,795,785 V611A probably damaging Het
Tenm4 T A 7: 96,893,086 D1935E probably damaging Het
Tep1 T C 14: 50,855,587 probably null Het
Tmppe T G 9: 114,405,481 S283A probably benign Het
Tmtc1 A G 6: 148,269,987 probably benign Het
Trp63 T C 16: 25,889,010 I552T unknown Het
Tspan2 C A 3: 102,749,835 D45E probably benign Het
Ubr1 T C 2: 120,882,264 E1396G probably benign Het
Usp17lc A T 7: 103,418,661 T388S probably benign Het
Wdr46 T C 17: 33,948,837 V508A possibly damaging Het
Zcchc11 T A 4: 108,520,292 D966E possibly damaging Het
Zfp462 T A 4: 55,010,667 Y878N probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp954 T A 7: 7,115,715 T277S probably benign Het
Other mutations in Rbm15b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01660:Rbm15b APN 9 106885709 missense probably damaging 1.00
IGL02514:Rbm15b APN 9 106884977 missense probably damaging 0.96
IGL02585:Rbm15b APN 9 106885826 missense probably benign 0.22
IGL02814:Rbm15b APN 9 106885776 missense probably benign 0.12
IGL03110:Rbm15b APN 9 106885974 missense probably damaging 1.00
IGL03335:Rbm15b APN 9 106884339 missense probably damaging 0.99
R0004:Rbm15b UTSW 9 106884936 missense probably benign 0.02
R0234:Rbm15b UTSW 9 106885364 missense probably damaging 1.00
R0234:Rbm15b UTSW 9 106885364 missense probably damaging 1.00
R0390:Rbm15b UTSW 9 106885998 missense probably benign 0.03
R1981:Rbm15b UTSW 9 106881623 unclassified probably benign
R2966:Rbm15b UTSW 9 106885592 missense probably damaging 1.00
R4085:Rbm15b UTSW 9 106885737 missense possibly damaging 0.80
R4890:Rbm15b UTSW 9 106885829 missense possibly damaging 0.86
R5081:Rbm15b UTSW 9 106884921 missense probably benign 0.01
R5513:Rbm15b UTSW 9 106886117 missense probably benign 0.02
R7341:Rbm15b UTSW 9 106885047 missense probably benign 0.35
R7711:Rbm15b UTSW 9 106885943 missense possibly damaging 0.67
R7842:Rbm15b UTSW 9 106885889 missense probably damaging 1.00
X0024:Rbm15b UTSW 9 106885379 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- AACACTGTGGTCCAGGTTGC -3'
(R):5'- TCTTCCACCAGTTCAAGCG -3'

Sequencing Primer
(F):5'- GTCCAGGTTGCCGATGAAG -3'
(R):5'- ACCAGTTCAAGCGGTTCG -3'
Posted On2016-06-15