Incidental Mutation 'R5118:Tmppe'
ID392750
Institutional Source Beutler Lab
Gene Symbol Tmppe
Ensembl Gene ENSMUSG00000079260
Gene Nametransmembrane protein with metallophosphoesterase domain
Synonyms
MMRRC Submission 042706-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.542) question?
Stock #R5118 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location114401105-114407276 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 114405481 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 283 (S283A)
Ref Sequence ENSEMBL: ENSMUSP00000107451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063042] [ENSMUST00000111820] [ENSMUST00000217583]
Predicted Effect probably benign
Transcript: ENSMUST00000063042
SMART Domains Protein: ENSMUSP00000055803
Gene: ENSMUSG00000045594

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Glyco_hydro_35 41 358 2.5e-129 PFAM
Pfam:Glyco_hydro_42 56 216 9.4e-15 PFAM
Pfam:BetaGal_dom4_5 531 623 4.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111820
AA Change: S283A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000107451
Gene: ENSMUSG00000079260
AA Change: S283A

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
transmembrane domain 42 64 N/A INTRINSIC
transmembrane domain 84 106 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:Metallophos 207 389 5.1e-13 PFAM
Pfam:Metallophos_2 207 421 7.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217583
Meta Mutation Damage Score 0.1775 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Adamts2 A G 11: 50,781,869 E648G probably damaging Het
Ankrd55 A G 13: 112,355,939 S187G probably benign Het
BC080695 T C 4: 143,571,127 L39P probably damaging Het
C87414 T A 5: 93,637,797 D208V probably benign Het
Cd44 C A 2: 102,865,370 E52D probably damaging Het
Col6a5 T A 9: 105,937,005 I603F unknown Het
Dmxl2 C A 9: 54,460,987 R233L probably damaging Het
Dopey1 T C 9: 86,506,259 F429L probably damaging Het
Epsti1 T G 14: 77,986,682 probably null Het
Erfe G T 1: 91,370,716 probably null Het
Galnt5 A G 2: 58,015,003 D526G probably damaging Het
Gm1330 T C 2: 149,002,986 probably benign Het
Gm6181 G A 7: 52,755,616 noncoding transcript Het
Irak2 T A 6: 113,665,811 V68D probably benign Het
Kdm1a A G 4: 136,557,358 probably benign Het
Kidins220 C A 12: 24,992,297 Q198K probably damaging Het
Lgr5 A G 10: 115,452,339 V728A possibly damaging Het
Micall2 G A 5: 139,716,447 T347M probably damaging Het
Mrap2 T C 9: 87,182,703 F166L possibly damaging Het
Msh3 A T 13: 92,309,434 probably benign Het
Mul1 T A 4: 138,439,349 L238Q probably damaging Het
Nuak1 G T 10: 84,374,984 H413Q probably benign Het
Olfr1408 T C 1: 173,130,917 Q100R possibly damaging Het
Pcnt C T 10: 76,412,168 A931T probably damaging Het
Pddc1 A T 7: 141,406,806 probably benign Het
Psmb4 T C 3: 94,884,942 Y223C probably damaging Het
Rbm15b G T 9: 106,886,102 A289E possibly damaging Het
Reg3b T A 6: 78,372,128 V79E probably damaging Het
Rsl1 A G 13: 67,181,981 I164M probably damaging Het
Rtp1 T C 16: 23,431,535 F217L probably benign Het
Sfmbt1 T C 14: 30,790,770 L360P probably damaging Het
Sorbs2 T C 8: 45,795,785 V611A probably damaging Het
Tenm4 T A 7: 96,893,086 D1935E probably damaging Het
Tep1 T C 14: 50,855,587 probably null Het
Tmtc1 A G 6: 148,269,987 probably benign Het
Trp63 T C 16: 25,889,010 I552T unknown Het
Tspan2 C A 3: 102,749,835 D45E probably benign Het
Ubr1 T C 2: 120,882,264 E1396G probably benign Het
Usp17lc A T 7: 103,418,661 T388S probably benign Het
Wdr46 T C 17: 33,948,837 V508A possibly damaging Het
Zcchc11 T A 4: 108,520,292 D966E possibly damaging Het
Zfp462 T A 4: 55,010,667 Y878N probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp954 T A 7: 7,115,715 T277S probably benign Het
Other mutations in Tmppe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01823:Tmppe APN 9 114405107 missense probably benign 0.03
IGL02274:Tmppe APN 9 114405431 missense probably benign
IGL02349:Tmppe APN 9 114405200 missense probably benign
R0201:Tmppe UTSW 9 114404639 frame shift probably null
R1668:Tmppe UTSW 9 114404900 missense possibly damaging 0.89
R2206:Tmppe UTSW 9 114405572 missense probably benign
R5026:Tmppe UTSW 9 114405819 missense possibly damaging 0.90
R5054:Tmppe UTSW 9 114405958 missense probably benign 0.41
R5623:Tmppe UTSW 9 114405896 missense possibly damaging 0.59
R6307:Tmppe UTSW 9 114404744 missense probably benign 0.00
R6502:Tmppe UTSW 9 114405652 missense probably damaging 1.00
R6597:Tmppe UTSW 9 114405244 missense probably benign 0.00
R6627:Tmppe UTSW 9 114405485 missense probably damaging 1.00
R6888:Tmppe UTSW 9 114404701 missense probably damaging 1.00
R6954:Tmppe UTSW 9 114405523 missense probably benign 0.06
R7032:Tmppe UTSW 9 114405790 missense probably damaging 1.00
R7141:Tmppe UTSW 9 114404968 missense probably benign 0.00
R7642:Tmppe UTSW 9 114404794 missense possibly damaging 0.95
Z1088:Tmppe UTSW 9 114405077 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTGACATTCACTTGGGGCC -3'
(R):5'- TTGTCAAGGTCCATGCCATG -3'

Sequencing Primer
(F):5'- ATTCACTTGGGGCCCACAGTG -3'
(R):5'- ATGCCATGCCCAGAGTAGTG -3'
Posted On2016-06-15