Incidental Mutation 'R5118:Ankrd55'
ID392762
Institutional Source Beutler Lab
Gene Symbol Ankrd55
Ensembl Gene ENSMUSG00000049985
Gene Nameankyrin repeat domain 55
SynonymsC030011J08Rik
MMRRC Submission 042706-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5118 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location112288451-112384002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112355939 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 187 (S187G)
Ref Sequence ENSEMBL: ENSMUSP00000126199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022275] [ENSMUST00000165593] [ENSMUST00000168684]
Predicted Effect probably benign
Transcript: ENSMUST00000022275
AA Change: S215G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022275
Gene: ENSMUSG00000049985
AA Change: S215G

DomainStartEndE-ValueType
Blast:ANK 25 54 1e-9 BLAST
ANK 59 88 7.64e-6 SMART
ANK 92 121 4.18e2 SMART
ANK 125 156 4.86e1 SMART
ANK 160 189 5.32e-5 SMART
ANK 193 222 7.59e-1 SMART
ANK 229 257 2.97e2 SMART
ANK 263 292 5.71e-5 SMART
ANK 296 326 1.63e0 SMART
low complexity region 528 543 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165593
AA Change: S187G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126199
Gene: ENSMUSG00000049985
AA Change: S187G

DomainStartEndE-ValueType
Blast:ANK 1 26 8e-8 BLAST
ANK 31 60 7.64e-6 SMART
ANK 64 93 4.18e2 SMART
ANK 97 128 4.86e1 SMART
ANK 132 161 5.32e-5 SMART
ANK 165 194 7.59e-1 SMART
ANK 201 229 2.97e2 SMART
ANK 235 264 5.71e-5 SMART
ANK 268 298 1.63e0 SMART
low complexity region 500 515 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168684
AA Change: S215G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129726
Gene: ENSMUSG00000049985
AA Change: S215G

DomainStartEndE-ValueType
Blast:ANK 25 54 9e-10 BLAST
ANK 59 88 7.64e-6 SMART
ANK 92 121 4.18e2 SMART
ANK 125 156 4.86e1 SMART
ANK 160 189 5.32e-5 SMART
ANK 193 222 7.59e-1 SMART
ANK 229 257 2.97e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224393
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Adamts2 A G 11: 50,781,869 E648G probably damaging Het
BC080695 T C 4: 143,571,127 L39P probably damaging Het
C87414 T A 5: 93,637,797 D208V probably benign Het
Cd44 C A 2: 102,865,370 E52D probably damaging Het
Col6a5 T A 9: 105,937,005 I603F unknown Het
Dmxl2 C A 9: 54,460,987 R233L probably damaging Het
Dopey1 T C 9: 86,506,259 F429L probably damaging Het
Epsti1 T G 14: 77,986,682 probably null Het
Erfe G T 1: 91,370,716 probably null Het
Galnt5 A G 2: 58,015,003 D526G probably damaging Het
Gm1330 T C 2: 149,002,986 probably benign Het
Gm6181 G A 7: 52,755,616 noncoding transcript Het
Irak2 T A 6: 113,665,811 V68D probably benign Het
Kdm1a A G 4: 136,557,358 probably benign Het
Kidins220 C A 12: 24,992,297 Q198K probably damaging Het
Lgr5 A G 10: 115,452,339 V728A possibly damaging Het
Micall2 G A 5: 139,716,447 T347M probably damaging Het
Mrap2 T C 9: 87,182,703 F166L possibly damaging Het
Msh3 A T 13: 92,309,434 probably benign Het
Mul1 T A 4: 138,439,349 L238Q probably damaging Het
Nuak1 G T 10: 84,374,984 H413Q probably benign Het
Olfr1408 T C 1: 173,130,917 Q100R possibly damaging Het
Pcnt C T 10: 76,412,168 A931T probably damaging Het
Pddc1 A T 7: 141,406,806 probably benign Het
Psmb4 T C 3: 94,884,942 Y223C probably damaging Het
Rbm15b G T 9: 106,886,102 A289E possibly damaging Het
Reg3b T A 6: 78,372,128 V79E probably damaging Het
Rsl1 A G 13: 67,181,981 I164M probably damaging Het
Rtp1 T C 16: 23,431,535 F217L probably benign Het
Sfmbt1 T C 14: 30,790,770 L360P probably damaging Het
Sorbs2 T C 8: 45,795,785 V611A probably damaging Het
Tenm4 T A 7: 96,893,086 D1935E probably damaging Het
Tep1 T C 14: 50,855,587 probably null Het
Tmppe T G 9: 114,405,481 S283A probably benign Het
Tmtc1 A G 6: 148,269,987 probably benign Het
Trp63 T C 16: 25,889,010 I552T unknown Het
Tspan2 C A 3: 102,749,835 D45E probably benign Het
Ubr1 T C 2: 120,882,264 E1396G probably benign Het
Usp17lc A T 7: 103,418,661 T388S probably benign Het
Wdr46 T C 17: 33,948,837 V508A possibly damaging Het
Zcchc11 T A 4: 108,520,292 D966E possibly damaging Het
Zfp462 T A 4: 55,010,667 Y878N probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp954 T A 7: 7,115,715 T277S probably benign Het
Other mutations in Ankrd55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Ankrd55 APN 13 112367794 missense probably benign 0.01
IGL01372:Ankrd55 APN 13 112323143 missense probably damaging 1.00
IGL01554:Ankrd55 APN 13 112323067 missense possibly damaging 0.87
IGL01700:Ankrd55 APN 13 112381168 missense probably benign 0.16
IGL02366:Ankrd55 APN 13 112318460 missense probably damaging 1.00
IGL03368:Ankrd55 APN 13 112318556 splice site probably benign
crescat UTSW 13 112348863 critical splice donor site probably null
I0000:Ankrd55 UTSW 13 112348725 splice site probably benign
R0547:Ankrd55 UTSW 13 112368223 missense probably benign 0.03
R0781:Ankrd55 UTSW 13 112381233 splice site probably benign
R0981:Ankrd55 UTSW 13 112323076 missense possibly damaging 0.78
R1072:Ankrd55 UTSW 13 112348842 missense possibly damaging 0.83
R1469:Ankrd55 UTSW 13 112367926 missense probably benign 0.39
R1469:Ankrd55 UTSW 13 112367926 missense probably benign 0.39
R2187:Ankrd55 UTSW 13 112383505 missense probably benign 0.01
R4430:Ankrd55 UTSW 13 112323183 critical splice donor site probably null
R4753:Ankrd55 UTSW 13 112363475 missense probably benign
R4846:Ankrd55 UTSW 13 112363454 missense probably benign 0.00
R4911:Ankrd55 UTSW 13 112323039 splice site probably null
R4996:Ankrd55 UTSW 13 112356088 missense possibly damaging 0.68
R5007:Ankrd55 UTSW 13 112367932 missense probably benign
R5077:Ankrd55 UTSW 13 112355988 missense probably benign 0.19
R5350:Ankrd55 UTSW 13 112336226 missense probably damaging 1.00
R5367:Ankrd55 UTSW 13 112318502 missense probably damaging 1.00
R5560:Ankrd55 UTSW 13 112383490 missense probably benign
R5888:Ankrd55 UTSW 13 112355919 missense possibly damaging 0.62
R6130:Ankrd55 UTSW 13 112318446 missense probably damaging 1.00
R6589:Ankrd55 UTSW 13 112348863 critical splice donor site probably null
R6994:Ankrd55 UTSW 13 112368300 missense probably benign 0.42
R7100:Ankrd55 UTSW 13 112356110 missense probably benign 0.00
R7247:Ankrd55 UTSW 13 112336253 missense probably damaging 0.97
R7340:Ankrd55 UTSW 13 112355963 missense probably damaging 0.99
R7694:Ankrd55 UTSW 13 112367964 missense probably damaging 1.00
R8053:Ankrd55 UTSW 13 112323153 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGGGTCTGTTAGTCCTC -3'
(R):5'- GAGTTGCCATGGATACCTGTC -3'

Sequencing Primer
(F):5'- TCTCTGAGAAGTTTTTGAAGTGATC -3'
(R):5'- TGGATACCTGTCATCCACATCCAG -3'
Posted On2016-06-15