Incidental Mutation 'R5118:Epsti1'
ID392766
Institutional Source Beutler Lab
Gene Symbol Epsti1
Ensembl Gene ENSMUSG00000022014
Gene Nameepithelial stromal interaction 1 (breast)
Synonyms5033415K03Rik, 2310046K10Rik, BRESI1
MMRRC Submission 042706-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R5118 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location77904239-78002657 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to G at 77986682 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022591]
Predicted Effect probably null
Transcript: ENSMUST00000022591
SMART Domains Protein: ENSMUSP00000022591
Gene: ENSMUSG00000022014

DomainStartEndE-ValueType
coiled coil region 111 180 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has been shown to promote tumor invasion and metastasis in some invasive cancer cells when overexpressed. Expression of this gene has been shown to be upregulated by direct binding of the Kruppel like factor 8 protein to promoter sequences. The translated protein interacts with the amino terminal region of the valosin containing protein gene product, resulting in the nuclear translocation of the nuclear factor kappa B subunit 1 gene product, and activation of target genes. Overexpression of this gene has been observed in some breast cancers and in some individuals with systemic lupus erythematosus (SLE). [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Adamts2 A G 11: 50,781,869 E648G probably damaging Het
Ankrd55 A G 13: 112,355,939 S187G probably benign Het
BC080695 T C 4: 143,571,127 L39P probably damaging Het
C87414 T A 5: 93,637,797 D208V probably benign Het
Cd44 C A 2: 102,865,370 E52D probably damaging Het
Col6a5 T A 9: 105,937,005 I603F unknown Het
Dmxl2 C A 9: 54,460,987 R233L probably damaging Het
Dopey1 T C 9: 86,506,259 F429L probably damaging Het
Erfe G T 1: 91,370,716 probably null Het
Galnt5 A G 2: 58,015,003 D526G probably damaging Het
Gm1330 T C 2: 149,002,986 probably benign Het
Gm6181 G A 7: 52,755,616 noncoding transcript Het
Irak2 T A 6: 113,665,811 V68D probably benign Het
Kdm1a A G 4: 136,557,358 probably benign Het
Kidins220 C A 12: 24,992,297 Q198K probably damaging Het
Lgr5 A G 10: 115,452,339 V728A possibly damaging Het
Micall2 G A 5: 139,716,447 T347M probably damaging Het
Mrap2 T C 9: 87,182,703 F166L possibly damaging Het
Msh3 A T 13: 92,309,434 probably benign Het
Mul1 T A 4: 138,439,349 L238Q probably damaging Het
Nuak1 G T 10: 84,374,984 H413Q probably benign Het
Olfr1408 T C 1: 173,130,917 Q100R possibly damaging Het
Pcnt C T 10: 76,412,168 A931T probably damaging Het
Pddc1 A T 7: 141,406,806 probably benign Het
Psmb4 T C 3: 94,884,942 Y223C probably damaging Het
Rbm15b G T 9: 106,886,102 A289E possibly damaging Het
Reg3b T A 6: 78,372,128 V79E probably damaging Het
Rsl1 A G 13: 67,181,981 I164M probably damaging Het
Rtp1 T C 16: 23,431,535 F217L probably benign Het
Sfmbt1 T C 14: 30,790,770 L360P probably damaging Het
Sorbs2 T C 8: 45,795,785 V611A probably damaging Het
Tenm4 T A 7: 96,893,086 D1935E probably damaging Het
Tep1 T C 14: 50,855,587 probably null Het
Tmppe T G 9: 114,405,481 S283A probably benign Het
Tmtc1 A G 6: 148,269,987 probably benign Het
Trp63 T C 16: 25,889,010 I552T unknown Het
Tspan2 C A 3: 102,749,835 D45E probably benign Het
Ubr1 T C 2: 120,882,264 E1396G probably benign Het
Usp17lc A T 7: 103,418,661 T388S probably benign Het
Wdr46 T C 17: 33,948,837 V508A possibly damaging Het
Zcchc11 T A 4: 108,520,292 D966E possibly damaging Het
Zfp462 T A 4: 55,010,667 Y878N probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp954 T A 7: 7,115,715 T277S probably benign Het
Other mutations in Epsti1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01787:Epsti1 APN 14 77972612 critical splice donor site probably null
IGL02749:Epsti1 APN 14 77939923 missense probably damaging 1.00
IGL03031:Epsti1 APN 14 77974581 missense probably benign 0.00
R0302:Epsti1 UTSW 14 77939926 missense probably damaging 0.97
R0605:Epsti1 UTSW 14 77927237 splice site probably benign
R0743:Epsti1 UTSW 14 77931275 missense probably damaging 1.00
R0884:Epsti1 UTSW 14 77931275 missense probably damaging 1.00
R1986:Epsti1 UTSW 14 77932233 critical splice donor site probably null
R3162:Epsti1 UTSW 14 77974513 splice site probably benign
R5296:Epsti1 UTSW 14 77904650 missense probably benign 0.03
R5392:Epsti1 UTSW 14 77986744 missense probably benign 0.00
R5664:Epsti1 UTSW 14 77963664 missense possibly damaging 0.73
R5948:Epsti1 UTSW 14 77939890 missense probably damaging 1.00
R6402:Epsti1 UTSW 14 77939878 missense probably damaging 0.98
R7494:Epsti1 UTSW 14 77928754 missense probably benign 0.10
R7520:Epsti1 UTSW 14 77963443 intron probably null
R7671:Epsti1 UTSW 14 77904490 missense probably damaging 1.00
R8039:Epsti1 UTSW 14 77931301 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CACTCACGGAGCTATTCTGTTAG -3'
(R):5'- TAGGAGTGATCTGGAGTCTAGAAC -3'

Sequencing Primer
(F):5'- CACGGAGCTATTCTGTTAGACTAAGC -3'
(R):5'- GTTTTCCCAAAATGCCGC -3'
Posted On2016-06-15