Incidental Mutation 'R5119:Dock10'
ID392771
Institutional Source Beutler Lab
Gene Symbol Dock10
Ensembl Gene ENSMUSG00000038608
Gene Namededicator of cytokinesis 10
SynonymsJr5, Zizimin3, A630054M16Rik, Jr4, 9330153B10Rik, ZIZ3
MMRRC Submission 042707-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.356) question?
Stock #R5119 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location80501073-80758527 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 80567994 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077946] [ENSMUST00000187774] [ENSMUST00000190595] [ENSMUST00000190983]
Predicted Effect probably null
Transcript: ENSMUST00000077946
SMART Domains Protein: ENSMUSP00000077099
Gene: ENSMUSG00000038608

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
Pfam:DUF3398 61 153 1.7e-36 PFAM
PH 182 292 8.5e-17 SMART
Blast:PH 350 458 7e-18 BLAST
Pfam:DOCK-C2 668 859 1e-50 PFAM
low complexity region 1269 1279 N/A INTRINSIC
low complexity region 1284 1295 N/A INTRINSIC
Pfam:DHR-2 1592 2143 1.3e-216 PFAM
low complexity region 2174 2187 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000187774
SMART Domains Protein: ENSMUSP00000140085
Gene: ENSMUSG00000038608

DomainStartEndE-ValueType
Pfam:DUF3398 46 141 9e-29 PFAM
PH 170 280 3.9e-19 SMART
Blast:PH 338 446 7e-18 BLAST
Pfam:DOCK-C2 655 848 1.5e-54 PFAM
low complexity region 1257 1267 N/A INTRINSIC
low complexity region 1272 1283 N/A INTRINSIC
low complexity region 1870 1890 N/A INTRINSIC
Pfam:Ded_cyto 1954 2131 3.4e-65 PFAM
low complexity region 2162 2175 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000190595
SMART Domains Protein: ENSMUSP00000139567
Gene: ENSMUSG00000038608

DomainStartEndE-ValueType
Blast:PH 3 111 5e-18 BLAST
Pfam:DOCK-C2 320 513 1.2e-54 PFAM
low complexity region 922 932 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 1508 1522 N/A INTRINSIC
Pfam:Ded_cyto 1588 1765 2.7e-65 PFAM
low complexity region 1783 1795 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000190983
SMART Domains Protein: ENSMUSP00000140719
Gene: ENSMUSG00000038608

DomainStartEndE-ValueType
Pfam:DUF3398 45 140 8.9e-29 PFAM
PH 169 279 3.9e-19 SMART
Blast:PH 337 445 7e-18 BLAST
Pfam:DOCK-C2 654 847 1.5e-54 PFAM
low complexity region 1256 1266 N/A INTRINSIC
low complexity region 1271 1282 N/A INTRINSIC
low complexity region 1869 1889 N/A INTRINSIC
Pfam:Ded_cyto 1953 2130 3.4e-65 PFAM
Meta Mutation Damage Score 0.9588 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (127/127)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family are guanosine nucleotide exchange factors for Rho GTPases and defined by the presence of conserved DOCK-homology regions. The encoded protein belongs to the D (or Zizimin) subfamily of DOCK proteins, which also contain an N-terminal pleckstrin homology domain. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction of B cell numbers in secondary lymphoid organs. Follicular B cells show membrane CD23 overexpression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930470P17Rik C A 2: 170,579,585 G125V unknown Het
Actr6 A T 10: 89,725,855 L143Q probably damaging Het
Adamts18 A G 8: 113,699,010 Y1207H probably benign Het
Adamts5 T A 16: 85,899,578 R230S probably benign Het
Adat2 A T 10: 13,556,906 N51Y probably damaging Het
Adgrv1 T C 13: 81,419,427 Y5209C possibly damaging Het
Ahnak G T 19: 9,013,644 M4097I probably benign Het
Akap13 A G 7: 75,687,252 T820A probably damaging Het
Als2cl C T 9: 110,890,819 R492C probably damaging Het
Aox3 G A 1: 58,188,524 probably null Het
Arid4b G A 13: 14,164,281 V446M probably benign Het
Armc2 A G 10: 41,922,148 L794P probably damaging Het
Atp6v0a1 T A 11: 101,020,515 M80K probably benign Het
Aup1 T C 6: 83,055,134 V94A probably damaging Het
Bank1 A T 3: 136,234,682 I180K possibly damaging Het
Becn1 A G 11: 101,291,395 L116P probably damaging Het
Bsg A G 10: 79,710,223 probably benign Het
Camk2a A T 18: 60,943,136 probably benign Het
Ccdc180 A G 4: 45,914,603 E706G possibly damaging Het
Cdk8 A T 5: 146,283,627 probably null Het
Cpne4 A G 9: 104,901,521 probably null Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Cyp2c38 C A 19: 39,460,621 G96V probably damaging Het
Dhx40 A G 11: 86,776,636 I261T probably damaging Het
Dnah10 T C 5: 124,779,258 F2038L probably damaging Het
Dnah7a A T 1: 53,698,692 D27E probably benign Het
Dst A T 1: 34,195,969 K3710* probably null Het
Dtl G T 1: 191,541,506 A430D probably damaging Het
Ece2 T C 16: 20,618,631 L241P probably damaging Het
Ecel1 T A 1: 87,151,139 Y526F probably benign Het
Enpp2 T A 15: 54,870,305 R420* probably null Het
Epb41 A C 4: 131,937,436 probably benign Het
Eppin T C 2: 164,589,451 Y85C probably damaging Het
Fam171a2 G A 11: 102,438,733 A400V probably damaging Het
Fam71b G A 11: 46,407,036 G389D probably damaging Het
Fem1c A C 18: 46,506,369 C189G probably damaging Het
Frmd4b A G 6: 97,300,314 V560A probably benign Het
Fsip2 A T 2: 82,988,191 D4756V probably damaging Het
Gabbr1 T C 17: 37,048,438 S102P probably damaging Het
Gm28042 G A 2: 120,034,643 A250T probably damaging Het
Gm42877 T C 14: 54,075,521 probably benign Het
Gm9762 A T 3: 78,966,400 noncoding transcript Het
Gpr183 G T 14: 121,954,863 T82N possibly damaging Het
Gps2 A G 11: 69,914,791 K45R probably benign Het
Gramd2 A G 9: 59,714,320 probably benign Het
Grap2 G A 15: 80,646,144 R155Q possibly damaging Het
Hsdl1 T A 8: 119,565,867 Y203F possibly damaging Het
Ifi204 A T 1: 173,755,668 I328N probably damaging Het
Igsf3 T A 3: 101,439,361 probably null Het
Il1rap T C 16: 26,624,199 I15T probably benign Het
Il23r A T 6: 67,466,316 C268S probably damaging Het
Irx4 A G 13: 73,268,921 T479A probably benign Het
Kcnk7 G A 19: 5,706,324 V193I probably benign Het
Kcnt1 G T 2: 25,909,322 probably benign Het
Kif13b T G 14: 64,757,453 C885G probably benign Het
Kif21b C A 1: 136,163,100 D1215E probably benign Het
Klhdc2 A G 12: 69,296,962 probably benign Het
Kmt2d G A 15: 98,847,194 probably benign Het
Lama4 A G 10: 39,048,054 N486S probably benign Het
Ldah G A 12: 8,227,237 A58T probably benign Het
Lrrc24 T C 15: 76,716,000 Q313R probably benign Het
Luzp1 A G 4: 136,543,397 D977G possibly damaging Het
Mrgpra4 A G 7: 47,981,718 L45P probably damaging Het
Mrps28 C T 3: 8,923,696 G34D possibly damaging Het
Myh8 A G 11: 67,298,358 E1120G probably damaging Het
Myt1l A G 12: 29,832,303 E499G unknown Het
Ncan C T 8: 70,115,025 E146K probably damaging Het
Nlgn1 A T 3: 25,433,794 D763E probably damaging Het
Olfr1259 A T 2: 89,943,803 I104N possibly damaging Het
Olfr1474 C T 19: 13,471,546 T192I probably benign Het
Olfr157 G T 4: 43,836,433 A19D probably benign Het
Olfr23 A T 11: 73,940,552 Y102F possibly damaging Het
Olfr742 T C 14: 50,515,509 F102L probably benign Het
Olfr765 T A 10: 129,046,842 I74F possibly damaging Het
Pak6 A T 2: 118,694,548 I552F probably damaging Het
Pcbp1 G A 6: 86,524,915 A334V probably damaging Het
Pclaf T C 9: 65,890,780 V32A probably benign Het
Pga5 T A 19: 10,676,689 H50L probably benign Het
Phyhipl A T 10: 70,569,074 D56E probably damaging Het
Pik3ap1 C T 19: 41,281,976 R758H probably benign Het
Plekha1 A G 7: 130,905,364 probably benign Het
Plekhm1 A T 11: 103,387,315 N318K possibly damaging Het
Ppargc1b G A 18: 61,307,654 A731V probably benign Het
Pptc7 T C 5: 122,313,781 V100A possibly damaging Het
Prl7a1 A T 13: 27,633,581 H233Q possibly damaging Het
Prpf40a A G 2: 53,144,849 F776L probably damaging Het
Prrc2c T C 1: 162,705,440 probably benign Het
Psmb1 T C 17: 15,498,262 M1V probably null Het
Ptpn3 A G 4: 57,218,513 F650S possibly damaging Het
Ranbp17 A T 11: 33,404,181 *577R probably null Het
Reln T A 5: 21,971,870 N1933Y probably benign Het
Rgl2 T A 17: 33,937,120 H727Q probably benign Het
Rhpn2 A G 7: 35,371,124 T160A probably damaging Het
Rlf G A 4: 121,147,455 H1443Y probably damaging Het
Rpgrip1l T C 8: 91,280,816 E382G probably damaging Het
Rxrb T C 17: 34,033,588 S50P probably benign Het
Scn4b A T 9: 45,147,758 E109V probably damaging Het
Scrib C T 15: 76,051,753 probably null Het
Slc22a29 A T 19: 8,217,830 V147D probably damaging Het
Slc4a4 A T 5: 88,954,862 E53V probably null Het
Slx4 A G 16: 4,001,199 S37P possibly damaging Het
Spag9 G A 11: 94,122,722 G1127D probably damaging Het
Srek1 T A 13: 103,752,556 probably benign Het
Supt5 G T 7: 28,316,370 P849Q probably damaging Het
Tex14 T C 11: 87,433,813 S2P probably damaging Het
Them7 A G 2: 105,378,808 T158A probably benign Het
Tldc1 A C 8: 119,768,143 L292R probably damaging Het
Tll2 A G 19: 41,130,509 V260A possibly damaging Het
Tlr6 A G 5: 64,954,301 V421A probably benign Het
Tmc3 T G 7: 83,615,010 C649G probably damaging Het
Tnn A G 1: 160,120,552 W864R probably damaging Het
Tsc2 A C 17: 24,603,280 V1095G probably benign Het
Vmn1r124 C T 7: 21,260,247 G124D probably damaging Het
Vmn2r116 T C 17: 23,387,164 V350A probably benign Het
Vps13d A G 4: 145,105,898 S2813P possibly damaging Het
Wrap53 T A 11: 69,563,932 M204L possibly damaging Het
Zfp277 A G 12: 40,328,688 V390A possibly damaging Het
Zfp687 A T 3: 95,011,676 S262T probably benign Het
Zfp831 T A 2: 174,705,310 S1429T probably benign Het
Znfx1 G A 2: 167,065,387 probably benign Het
Other mutations in Dock10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Dock10 APN 1 80585012 missense probably damaging 1.00
IGL00783:Dock10 APN 1 80572449 splice site probably benign
IGL00784:Dock10 APN 1 80572449 splice site probably benign
IGL00858:Dock10 APN 1 80568003 missense possibly damaging 0.48
IGL01298:Dock10 APN 1 80531245 missense probably damaging 1.00
IGL01351:Dock10 APN 1 80593159 missense probably damaging 1.00
IGL01356:Dock10 APN 1 80523742 missense probably damaging 1.00
IGL01584:Dock10 APN 1 80533850 missense probably damaging 0.99
IGL01619:Dock10 APN 1 80634298 splice site probably benign
IGL01678:Dock10 APN 1 80543352 missense probably damaging 1.00
IGL01759:Dock10 APN 1 80526273 missense probably damaging 1.00
IGL02238:Dock10 APN 1 80533793 missense probably damaging 0.99
IGL02352:Dock10 APN 1 80505661 missense probably damaging 1.00
IGL02359:Dock10 APN 1 80505661 missense probably damaging 1.00
IGL02377:Dock10 APN 1 80584994 critical splice donor site probably null
IGL02433:Dock10 APN 1 80530188 missense probably damaging 1.00
IGL02471:Dock10 APN 1 80515622 missense probably damaging 0.99
IGL02645:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02646:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02648:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02649:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02650:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02652:Dock10 APN 1 80592844 unclassified probably null
IGL02718:Dock10 APN 1 80523818 missense probably benign 0.00
IGL02998:Dock10 APN 1 80573542 missense probably damaging 1.00
IGL03057:Dock10 APN 1 80567371 missense probably damaging 1.00
IGL03066:Dock10 APN 1 80585041 missense probably benign 0.00
IGL03106:Dock10 APN 1 80568834 missense probably damaging 0.98
IGL03148:Dock10 APN 1 80540358 missense probably benign 0.01
IGL03271:Dock10 APN 1 80505409 missense probably damaging 1.00
IGL03352:Dock10 APN 1 80606296 splice site probably benign
LCD18:Dock10 UTSW 1 80716623 intron probably benign
PIT4366001:Dock10 UTSW 1 80595721 missense probably benign 0.30
PIT4581001:Dock10 UTSW 1 80505446 missense probably damaging 1.00
R0019:Dock10 UTSW 1 80605925 missense probably damaging 1.00
R0081:Dock10 UTSW 1 80606578 missense probably damaging 0.99
R0095:Dock10 UTSW 1 80524071 missense probably benign 0.00
R0241:Dock10 UTSW 1 80578623 missense probably benign
R0241:Dock10 UTSW 1 80578623 missense probably benign
R0255:Dock10 UTSW 1 80605876 missense probably damaging 1.00
R0267:Dock10 UTSW 1 80512454 missense probably damaging 1.00
R0299:Dock10 UTSW 1 80536929 missense probably damaging 0.99
R0365:Dock10 UTSW 1 80595683 missense probably damaging 1.00
R0387:Dock10 UTSW 1 80540276 missense probably damaging 1.00
R0403:Dock10 UTSW 1 80524070 missense possibly damaging 0.94
R0408:Dock10 UTSW 1 80540476 missense probably benign 0.03
R0414:Dock10 UTSW 1 80535933 missense possibly damaging 0.93
R0591:Dock10 UTSW 1 80541219 splice site probably benign
R0698:Dock10 UTSW 1 80530178 missense probably damaging 1.00
R0711:Dock10 UTSW 1 80523975 missense probably damaging 1.00
R0925:Dock10 UTSW 1 80536940 missense probably benign 0.20
R1162:Dock10 UTSW 1 80568842 missense possibly damaging 0.58
R1370:Dock10 UTSW 1 80540343 missense probably damaging 1.00
R1440:Dock10 UTSW 1 80549136 missense probably benign 0.03
R1469:Dock10 UTSW 1 80512558 missense probably benign 0.05
R1469:Dock10 UTSW 1 80512558 missense probably benign 0.05
R1525:Dock10 UTSW 1 80606164 critical splice donor site probably null
R1544:Dock10 UTSW 1 80592635 missense probably benign 0.00
R1601:Dock10 UTSW 1 80549802 missense probably benign 0.00
R1757:Dock10 UTSW 1 80533869 missense probably damaging 1.00
R1765:Dock10 UTSW 1 80605823 missense probably damaging 1.00
R1783:Dock10 UTSW 1 80574180 missense probably benign 0.17
R1823:Dock10 UTSW 1 80543097 splice site probably null
R1827:Dock10 UTSW 1 80530292 missense probably benign 0.07
R1844:Dock10 UTSW 1 80543201 missense probably damaging 0.99
R1856:Dock10 UTSW 1 80606568 missense possibly damaging 0.46
R1974:Dock10 UTSW 1 80510426 missense possibly damaging 0.50
R2006:Dock10 UTSW 1 80549789 missense possibly damaging 0.95
R2112:Dock10 UTSW 1 80505642 missense probably damaging 1.00
R2112:Dock10 UTSW 1 80505643 missense probably damaging 0.99
R2113:Dock10 UTSW 1 80606563 missense probably damaging 1.00
R2439:Dock10 UTSW 1 80532432 missense probably damaging 1.00
R2566:Dock10 UTSW 1 80540253 missense possibly damaging 0.88
R3086:Dock10 UTSW 1 80532357 missense possibly damaging 0.91
R3766:Dock10 UTSW 1 80536926 missense probably damaging 0.99
R3768:Dock10 UTSW 1 80532368 missense probably damaging 1.00
R4009:Dock10 UTSW 1 80532431 missense probably damaging 1.00
R4016:Dock10 UTSW 1 80606569 missense probably damaging 1.00
R4179:Dock10 UTSW 1 80510417 missense probably benign 0.00
R4243:Dock10 UTSW 1 80566755 missense probably benign 0.00
R4244:Dock10 UTSW 1 80566755 missense probably benign 0.00
R4245:Dock10 UTSW 1 80566755 missense probably benign 0.00
R4674:Dock10 UTSW 1 80606620 missense possibly damaging 0.79
R4696:Dock10 UTSW 1 80515613 missense possibly damaging 0.95
R4789:Dock10 UTSW 1 80541281 missense probably damaging 1.00
R4851:Dock10 UTSW 1 80549157 missense probably benign 0.33
R4911:Dock10 UTSW 1 80606236 missense probably damaging 1.00
R4976:Dock10 UTSW 1 80567994 critical splice donor site probably null
R5086:Dock10 UTSW 1 80551472 missense possibly damaging 0.89
R5301:Dock10 UTSW 1 80648256 missense probably benign 0.41
R5404:Dock10 UTSW 1 80503913 intron probably benign
R5457:Dock10 UTSW 1 80524064 missense probably damaging 1.00
R5790:Dock10 UTSW 1 80505170 missense probably benign 0.00
R5845:Dock10 UTSW 1 80505742 intron probably benign
R5871:Dock10 UTSW 1 80541340 critical splice acceptor site probably null
R5873:Dock10 UTSW 1 80574138 missense probably damaging 1.00
R5881:Dock10 UTSW 1 80560923 missense probably benign 0.19
R5895:Dock10 UTSW 1 80536959 missense probably benign
R5935:Dock10 UTSW 1 80505587 intron probably benign
R5965:Dock10 UTSW 1 80568744 splice site probably null
R5966:Dock10 UTSW 1 80568508 missense possibly damaging 0.84
R6008:Dock10 UTSW 1 80606173 missense probably damaging 0.98
R6029:Dock10 UTSW 1 80536946 missense possibly damaging 0.68
R6083:Dock10 UTSW 1 80532431 missense probably damaging 1.00
R6145:Dock10 UTSW 1 80575904 nonsense probably null
R6257:Dock10 UTSW 1 80503696 intron probably benign
R6274:Dock10 UTSW 1 80538823 missense probably damaging 1.00
R6324:Dock10 UTSW 1 80505176 missense probably benign 0.03
R6346:Dock10 UTSW 1 80575856 splice site probably null
R6476:Dock10 UTSW 1 80541242 nonsense probably null
R6516:Dock10 UTSW 1 80540461 missense probably damaging 1.00
R6526:Dock10 UTSW 1 80586351 missense probably damaging 0.97
R6534:Dock10 UTSW 1 80503671 missense probably benign 0.01
R6620:Dock10 UTSW 1 80592638 missense probably benign 0.01
R6640:Dock10 UTSW 1 80533838 nonsense probably null
R6669:Dock10 UTSW 1 80592855 missense probably damaging 1.00
R6672:Dock10 UTSW 1 80512531 missense probably benign 0.00
R6679:Dock10 UTSW 1 80566797 missense probably benign 0.11
R6682:Dock10 UTSW 1 80512621 missense probably damaging 1.00
R6712:Dock10 UTSW 1 80536866 missense probably benign 0.00
R6726:Dock10 UTSW 1 80512430 missense probably damaging 1.00
R6788:Dock10 UTSW 1 80531245 missense probably damaging 1.00
R6805:Dock10 UTSW 1 80586690 missense probably benign
R6815:Dock10 UTSW 1 80538859 missense possibly damaging 0.94
R6818:Dock10 UTSW 1 80615365 missense possibly damaging 0.95
R6867:Dock10 UTSW 1 80531259 missense probably damaging 1.00
R6964:Dock10 UTSW 1 80503648 intron probably benign
R7026:Dock10 UTSW 1 80501787 missense probably benign 0.40
R7084:Dock10 UTSW 1 80503856 missense
R7087:Dock10 UTSW 1 80592826 missense probably benign
R7158:Dock10 UTSW 1 80586872 critical splice acceptor site probably null
R7191:Dock10 UTSW 1 80540331 missense possibly damaging 0.93
R7214:Dock10 UTSW 1 80568529 missense probably benign 0.01
R7255:Dock10 UTSW 1 80543099 critical splice donor site probably null
R7320:Dock10 UTSW 1 80549704 critical splice donor site probably null
R7359:Dock10 UTSW 1 80709348 missense probably benign 0.01
R7423:Dock10 UTSW 1 80523780 missense possibly damaging 0.67
R7464:Dock10 UTSW 1 80540315 missense probably damaging 0.99
R7483:Dock10 UTSW 1 80515566 missense probably benign 0.01
R7487:Dock10 UTSW 1 80585048 missense probably benign 0.00
R7789:Dock10 UTSW 1 80559213 missense possibly damaging 0.82
RF021:Dock10 UTSW 1 80564573 critical splice acceptor site probably null
X0025:Dock10 UTSW 1 80536920 missense probably damaging 0.98
X0065:Dock10 UTSW 1 80541260 missense probably damaging 1.00
Z1088:Dock10 UTSW 1 80532347 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGGTCAAATTGTCCTGGCAAG -3'
(R):5'- GCAGTAATGGCTCAGAACATC -3'

Sequencing Primer
(F):5'- AAGGGCATGGCATCCTGTG -3'
(R):5'- GTAATGGCTCAGAACATCAAATTAAC -3'
Posted On2016-06-15