Mutagenetix > Incidental Mutation

Incidental Mutation 'R5119:Igsf3'

392795

Institutional Source

Beutler Lab

Gene Symbol

Igsf3

Ensembl Gene

ENSMUSG00000042035

Gene Name

immunoglobulin superfamily, member 3

Synonyms

1700016K10Rik, 4833439O17Rik, 2810035F16Rik

MMRRC Submission

042707-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.288) question?

Stock #

R5119 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101377083-101463059 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 101439361 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000141823 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043983] [ENSMUST00000195164]

AlphaFold

Q6ZQA6

Predicted Effect

probably null
Transcript: ENSMUST00000043983

SMART Domains

Protein: ENSMUSP00000048900
Gene: ENSMUSG00000042035

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IG	27	142	7.7e-5	SMART
IG	152	275	1.99e-7	SMART
IG	287	405	1.79e0	SMART
IG	417	539	6.26e-5	SMART
IG	553	674	3.16e-1	SMART
IG	686	811	4.89e-7	SMART
IG	823	947	8.38e-6	SMART
IG	959	1109	6.97e-3	SMART
transmembrane domain	1125	1147	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000195164

SMART Domains

Protein: ENSMUSP00000141823
Gene: ENSMUSG00000042035

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IG	27	142	3.1e-7	SMART
IG	152	275	8.2e-10	SMART
IG	287	405	7.4e-3	SMART
IG	437	559	2.5e-7	SMART
IG	573	694	1.3e-3	SMART
IG	706	831	1.9e-9	SMART
IG	843	967	3.4e-8	SMART
IG	979	1129	2.9e-5	SMART
transmembrane domain	1145	1167	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

100% (127/127)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an immunoglobulin-like membrane protein containing several V-type Ig-like domains. A mutation in this gene has been associated with bilateral nasolacrimal duct obstruction (LCDD). [provided by RefSeq, Jun 2016]

Allele List at MGI

Other mutations in this stock

Total: 120 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930470P17Rik	C	A	2: 170,579,585	G125V	unknown	Het
Actr6	A	T	10: 89,725,855	L143Q	probably damaging	Het
Adamts18	A	G	8: 113,699,010	Y1207H	probably benign	Het
Adamts5	T	A	16: 85,899,578	R230S	probably benign	Het
Adat2	A	T	10: 13,556,906	N51Y	probably damaging	Het
Adgrv1	T	C	13: 81,419,427	Y5209C	possibly damaging	Het
Ahnak	G	T	19: 9,013,644	M4097I	probably benign	Het
Akap13	A	G	7: 75,687,252	T820A	probably damaging	Het
Als2cl	C	T	9: 110,890,819	R492C	probably damaging	Het
Aox3	G	A	1: 58,188,524		probably null	Het
Arid4b	G	A	13: 14,164,281	V446M	probably benign	Het
Armc2	A	G	10: 41,922,148	L794P	probably damaging	Het
Atp6v0a1	T	A	11: 101,020,515	M80K	probably benign	Het
Aup1	T	C	6: 83,055,134	V94A	probably damaging	Het
Bank1	A	T	3: 136,234,682	I180K	possibly damaging	Het
Becn1	A	G	11: 101,291,395	L116P	probably damaging	Het
Bsg	A	G	10: 79,710,223		probably benign	Het
Camk2a	A	T	18: 60,943,136		probably benign	Het
Ccdc180	A	G	4: 45,914,603	E706G	possibly damaging	Het
Cdk8	A	T	5: 146,283,627		probably null	Het
Cpne4	A	G	9: 104,901,521		probably null	Het
Cspp1	T	A	1: 10,126,463	N900K	probably damaging	Het
Cyp2c38	C	A	19: 39,460,621	G96V	probably damaging	Het
Dhx40	A	G	11: 86,776,636	I261T	probably damaging	Het
Dnah10	T	C	5: 124,779,258	F2038L	probably damaging	Het
Dnah7a	A	T	1: 53,698,692	D27E	probably benign	Het
Dock10	A	T	1: 80,567,994		probably null	Het
Dst	A	T	1: 34,195,969	K3710*	probably null	Het
Dtl	G	T	1: 191,541,506	A430D	probably damaging	Het
Ece2	T	C	16: 20,618,631	L241P	probably damaging	Het
Ecel1	T	A	1: 87,151,139	Y526F	probably benign	Het
Enpp2	T	A	15: 54,870,305	R420*	probably null	Het
Epb41	A	C	4: 131,937,436		probably benign	Het
Eppin	T	C	2: 164,589,451	Y85C	probably damaging	Het
Fam171a2	G	A	11: 102,438,733	A400V	probably damaging	Het
Fam71b	G	A	11: 46,407,036	G389D	probably damaging	Het
Fem1c	A	C	18: 46,506,369	C189G	probably damaging	Het
Frmd4b	A	G	6: 97,300,314	V560A	probably benign	Het
Fsip2	A	T	2: 82,988,191	D4756V	probably damaging	Het
Gabbr1	T	C	17: 37,048,438	S102P	probably damaging	Het
Gm28042	G	A	2: 120,034,643	A250T	probably damaging	Het
Gm42877	T	C	14: 54,075,521		probably benign	Het
Gm9762	A	T	3: 78,966,400		noncoding transcript	Het
Gpr183	G	T	14: 121,954,863	T82N	possibly damaging	Het
Gps2	A	G	11: 69,914,791	K45R	probably benign	Het
Gramd2	A	G	9: 59,714,320		probably benign	Het
Grap2	G	A	15: 80,646,144	R155Q	possibly damaging	Het
Hsdl1	T	A	8: 119,565,867	Y203F	possibly damaging	Het
Ifi204	A	T	1: 173,755,668	I328N	probably damaging	Het
Il1rap	T	C	16: 26,624,199	I15T	probably benign	Het
Il23r	A	T	6: 67,466,316	C268S	probably damaging	Het
Irx4	A	G	13: 73,268,921	T479A	probably benign	Het
Kcnk7	G	A	19: 5,706,324	V193I	probably benign	Het
Kcnt1	G	T	2: 25,909,322		probably benign	Het
Kif13b	T	G	14: 64,757,453	C885G	probably benign	Het
Kif21b	C	A	1: 136,163,100	D1215E	probably benign	Het
Klhdc2	A	G	12: 69,296,962		probably benign	Het
Kmt2d	G	A	15: 98,847,194		probably benign	Het
Lama4	A	G	10: 39,048,054	N486S	probably benign	Het
Ldah	G	A	12: 8,227,237	A58T	probably benign	Het
Lrrc24	T	C	15: 76,716,000	Q313R	probably benign	Het
Luzp1	A	G	4: 136,543,397	D977G	possibly damaging	Het
Mrgpra4	A	G	7: 47,981,718	L45P	probably damaging	Het
Mrps28	C	T	3: 8,923,696	G34D	possibly damaging	Het
Myh8	A	G	11: 67,298,358	E1120G	probably damaging	Het
Myt1l	A	G	12: 29,832,303	E499G	unknown	Het
Ncan	C	T	8: 70,115,025	E146K	probably damaging	Het
Nlgn1	A	T	3: 25,433,794	D763E	probably damaging	Het
Olfr1259	A	T	2: 89,943,803	I104N	possibly damaging	Het
Olfr1474	C	T	19: 13,471,546	T192I	probably benign	Het
Olfr157	G	T	4: 43,836,433	A19D	probably benign	Het
Olfr23	A	T	11: 73,940,552	Y102F	possibly damaging	Het
Olfr742	T	C	14: 50,515,509	F102L	probably benign	Het
Olfr765	T	A	10: 129,046,842	I74F	possibly damaging	Het
Pak6	A	T	2: 118,694,548	I552F	probably damaging	Het
Pcbp1	G	A	6: 86,524,915	A334V	probably damaging	Het
Pclaf	T	C	9: 65,890,780	V32A	probably benign	Het
Pga5	T	A	19: 10,676,689	H50L	probably benign	Het
Phyhipl	A	T	10: 70,569,074	D56E	probably damaging	Het
Pik3ap1	C	T	19: 41,281,976	R758H	probably benign	Het
Plekha1	A	G	7: 130,905,364		probably benign	Het
Plekhm1	A	T	11: 103,387,315	N318K	possibly damaging	Het
Ppargc1b	G	A	18: 61,307,654	A731V	probably benign	Het
Pptc7	T	C	5: 122,313,781	V100A	possibly damaging	Het
Prl7a1	A	T	13: 27,633,581	H233Q	possibly damaging	Het
Prpf40a	A	G	2: 53,144,849	F776L	probably damaging	Het
Prrc2c	T	C	1: 162,705,440		probably benign	Het
Psmb1	T	C	17: 15,498,262	M1V	probably null	Het
Ptpn3	A	G	4: 57,218,513	F650S	possibly damaging	Het
Ranbp17	A	T	11: 33,404,181	*577R	probably null	Het
Reln	T	A	5: 21,971,870	N1933Y	probably benign	Het
Rgl2	T	A	17: 33,937,120	H727Q	probably benign	Het
Rhpn2	A	G	7: 35,371,124	T160A	probably damaging	Het
Rlf	G	A	4: 121,147,455	H1443Y	probably damaging	Het
Rpgrip1l	T	C	8: 91,280,816	E382G	probably damaging	Het
Rxrb	T	C	17: 34,033,588	S50P	probably benign	Het
Scn4b	A	T	9: 45,147,758	E109V	probably damaging	Het
Scrib	C	T	15: 76,051,753		probably null	Het
Slc22a29	A	T	19: 8,217,830	V147D	probably damaging	Het
Slc4a4	A	T	5: 88,954,862	E53V	probably null	Het
Slx4	A	G	16: 4,001,199	S37P	possibly damaging	Het
Spag9	G	A	11: 94,122,722	G1127D	probably damaging	Het
Srek1	T	A	13: 103,752,556		probably benign	Het
Supt5	G	T	7: 28,316,370	P849Q	probably damaging	Het
Tex14	T	C	11: 87,433,813	S2P	probably damaging	Het
Them7	A	G	2: 105,378,808	T158A	probably benign	Het
Tldc1	A	C	8: 119,768,143	L292R	probably damaging	Het
Tll2	A	G	19: 41,130,509	V260A	possibly damaging	Het
Tlr6	A	G	5: 64,954,301	V421A	probably benign	Het
Tmc3	T	G	7: 83,615,010	C649G	probably damaging	Het
Tnn	A	G	1: 160,120,552	W864R	probably damaging	Het
Tsc2	A	C	17: 24,603,280	V1095G	probably benign	Het
Vmn1r124	C	T	7: 21,260,247	G124D	probably damaging	Het
Vmn2r116	T	C	17: 23,387,164	V350A	probably benign	Het
Vps13d	A	G	4: 145,105,898	S2813P	possibly damaging	Het
Wrap53	T	A	11: 69,563,932	M204L	possibly damaging	Het
Zfp277	A	G	12: 40,328,688	V390A	possibly damaging	Het
Zfp687	A	T	3: 95,011,676	S262T	probably benign	Het
Zfp831	T	A	2: 174,705,310	S1429T	probably benign	Het
Znfx1	G	A	2: 167,065,387		probably benign	Het

Other mutations in Igsf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00783:Igsf3	APN	3	101431239	missense	probably damaging	0.99
IGL00907:Igsf3	APN	3	101427448	splice site	probably benign
IGL01321:Igsf3	APN	3	101427022	splice site	probably benign
IGL01340:Igsf3	APN	3	101439679	nonsense	probably null
IGL02291:Igsf3	APN	3	101439529	missense	probably damaging	1.00
Bunsen	UTSW	3	101451296	critical splice donor site	probably null
residue	UTSW	3	101435435	missense	probably damaging	0.99
weaksister	UTSW	3	101451077	nonsense	probably null
PIT4402001:Igsf3	UTSW	3	101427077	missense	probably benign	0.00
R0090:Igsf3	UTSW	3	101435652	missense	probably damaging	1.00
R0143:Igsf3	UTSW	3	101435601	missense	probably damaging	1.00
R0418:Igsf3	UTSW	3	101435435	missense	probably damaging	0.99
R0711:Igsf3	UTSW	3	101427393	missense	probably benign	0.31
R1195:Igsf3	UTSW	3	101458103	missense	probably benign	0.05
R1195:Igsf3	UTSW	3	101458103	missense	probably benign	0.05
R1195:Igsf3	UTSW	3	101458103	missense	probably benign	0.05
R1384:Igsf3	UTSW	3	101451296	critical splice donor site	probably null
R1594:Igsf3	UTSW	3	101451077	nonsense	probably null
R1624:Igsf3	UTSW	3	101455227	missense	probably benign	0.37
R1766:Igsf3	UTSW	3	101431282	missense	probably damaging	1.00
R1988:Igsf3	UTSW	3	101431296	missense	probably benign	0.03
R2072:Igsf3	UTSW	3	101439515	missense	probably benign	0.02
R4707:Igsf3	UTSW	3	101458094	missense	probably benign	0.06
R4976:Igsf3	UTSW	3	101439361	splice site	probably null
R4982:Igsf3	UTSW	3	101435667	missense	probably benign	0.42
R5008:Igsf3	UTSW	3	101450917	missense	probably damaging	0.97
R5189:Igsf3	UTSW	3	101431527	missense	possibly damaging	0.64
R5456:Igsf3	UTSW	3	101427221	missense	probably benign	0.20
R5776:Igsf3	UTSW	3	101425480	missense	probably benign	0.01
R6112:Igsf3	UTSW	3	101451006	missense	probably damaging	1.00
R6383:Igsf3	UTSW	3	101435648	missense	probably benign	0.05
R6758:Igsf3	UTSW	3	101425498	missense	probably damaging	0.98
R7085:Igsf3	UTSW	3	101455489	missense	probably benign	0.12
R7310:Igsf3	UTSW	3	101431579	missense	probably benign	0.01
R7470:Igsf3	UTSW	3	101451075	missense	possibly damaging	0.67
R7707:Igsf3	UTSW	3	101459922	missense	probably benign	0.00
R7719:Igsf3	UTSW	3	101435541	missense	probably damaging	1.00
R7739:Igsf3	UTSW	3	101435531	missense	probably damaging	1.00
R8115:Igsf3	UTSW	3	101455279	missense	probably benign	0.01
R8128:Igsf3	UTSW	3	101439631	missense	probably damaging	1.00
R8221:Igsf3	UTSW	3	101439722	missense	probably damaging	1.00
R8716:Igsf3	UTSW	3	101427423	missense	probably damaging	1.00
R8730:Igsf3	UTSW	3	101427216	missense	probably benign	0.00
R9401:Igsf3	UTSW	3	101425759	missense	probably damaging	1.00
R9449:Igsf3	UTSW	3	101451006	missense	probably damaging	1.00
R9483:Igsf3	UTSW	3	101439501	missense	probably damaging	0.98
R9483:Igsf3	UTSW	3	101439588	missense	probably damaging	1.00
R9575:Igsf3	UTSW	3	101431309	missense	probably damaging	1.00
R9782:Igsf3	UTSW	3	101431296	missense	probably benign	0.03
X0027:Igsf3	UTSW	3	101435645	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGACCCGTGAAGTCTTAGGAAC -3'
(R):5'- AAAGTGGATGACTTGTCCCC -3'

Sequencing Primer
(F):5'- ACCCGTGAAGTCTTAGGAACTGTTG -3'
(R):5'- GAACCCCTCCATCTCGTGTGAAG -3'

Posted On

2016-06-15