Mutagenetix > Incidental Mutations

Incidental Mutation 'R5119:Slc4a4'

392807

Institutional Source

Beutler Lab

Gene Symbol

Slc4a4

Ensembl Gene

ENSMUSG00000060961

Gene Name

solute carrier family 4 (anion exchanger), member 4

Synonyms

NBC1, NBC

MMRRC Submission

042707-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5119 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88886818-89239653 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 88954862 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 53 (E53V)

Ref Sequence

ENSEMBL: ENSMUSP00000121744 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113218] [ENSMUST00000144713] [ENSMUST00000148750] [ENSMUST00000156238]

Predicted Effect

probably null
Transcript: ENSMUST00000113218
AA Change: E53V

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000108844
Gene: ENSMUSG00000060961
AA Change: E53V

Domain	Start	End	E-Value	Type
low complexity region	40	59	N/A	INTRINSIC
low complexity region	76	87	N/A	INTRINSIC
Pfam:Band_3_cyto	137	379	1.1e-100	PFAM
low complexity region	408	423	N/A	INTRINSIC
Pfam:HCO3_cotransp	426	947	3e-246	PFAM
transmembrane domain	953	975	N/A	INTRINSIC
low complexity region	999	1015	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000144713
AA Change: E58V

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000122975
Gene: ENSMUSG00000060961
AA Change: E58V

Domain	Start	End	E-Value	Type
low complexity region	45	64	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000148750
AA Change: E53V

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000119325
Gene: ENSMUSG00000060961
AA Change: E53V

Domain	Start	End	E-Value	Type
low complexity region	40	59	N/A	INTRINSIC
low complexity region	76	87	N/A	INTRINSIC
Pfam:Band_3_cyto	137	388	3.7e-101	PFAM
low complexity region	417	432	N/A	INTRINSIC
Pfam:HCO3_cotransp	435	956	7.3e-246	PFAM
transmembrane domain	962	984	N/A	INTRINSIC
low complexity region	1008	1024	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000156238
AA Change: E53V

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000121744
Gene: ENSMUSG00000060961
AA Change: E53V

Domain	Start	End	E-Value	Type
low complexity region	40	59	N/A	INTRINSIC
low complexity region	76	87	N/A	INTRINSIC
Pfam:Band_3_cyto	137	388	4.6e-101	PFAM
low complexity region	417	432	N/A	INTRINSIC
Pfam:HCO3_cotransp	436	956	4.1e-231	PFAM
transmembrane domain	962	984	N/A	INTRINSIC
low complexity region	1008	1024	N/A	INTRINSIC

Meta Mutation Damage Score

0.0936

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

100% (127/127)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium bicarbonate cotransporter (NBC) involved in the regulation of bicarbonate secretion and absorption and intracellular pH. Mutations in this gene are associated with proximal renal tubular acidosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit smaller birth size, growth retardation, postnatal lethality, bowel obstructions, altered blood chemistry, acidosis, spleen defects and defects in ion homeostasis. Heterozygotes have decreased levels of circulating bicarbonate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 120 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930470P17Rik	C	A	2: 170,579,585	G125V	unknown	Het
Actr6	A	T	10: 89,725,855	L143Q	probably damaging	Het
Adamts18	A	G	8: 113,699,010	Y1207H	probably benign	Het
Adamts5	T	A	16: 85,899,578	R230S	probably benign	Het
Adat2	A	T	10: 13,556,906	N51Y	probably damaging	Het
Adgrv1	T	C	13: 81,419,427	Y5209C	possibly damaging	Het
Ahnak	G	T	19: 9,013,644	M4097I	probably benign	Het
Akap13	A	G	7: 75,687,252	T820A	probably damaging	Het
Als2cl	C	T	9: 110,890,819	R492C	probably damaging	Het
Aox3	G	A	1: 58,188,524		probably null	Het
Arid4b	G	A	13: 14,164,281	V446M	probably benign	Het
Armc2	A	G	10: 41,922,148	L794P	probably damaging	Het
Atp6v0a1	T	A	11: 101,020,515	M80K	probably benign	Het
Aup1	T	C	6: 83,055,134	V94A	probably damaging	Het
Bank1	A	T	3: 136,234,682	I180K	possibly damaging	Het
Becn1	A	G	11: 101,291,395	L116P	probably damaging	Het
Bsg	A	G	10: 79,710,223		probably benign	Het
Camk2a	A	T	18: 60,943,136		probably benign	Het
Ccdc180	A	G	4: 45,914,603	E706G	possibly damaging	Het
Cdk8	A	T	5: 146,283,627		probably null	Het
Cpne4	A	G	9: 104,901,521		probably null	Het
Cspp1	T	A	1: 10,126,463	N900K	probably damaging	Het
Cyp2c38	C	A	19: 39,460,621	G96V	probably damaging	Het
Dhx40	A	G	11: 86,776,636	I261T	probably damaging	Het
Dnah10	T	C	5: 124,779,258	F2038L	probably damaging	Het
Dnah7a	A	T	1: 53,698,692	D27E	probably benign	Het
Dock10	A	T	1: 80,567,994		probably null	Het
Dst	A	T	1: 34,195,969	K3710*	probably null	Het
Dtl	G	T	1: 191,541,506	A430D	probably damaging	Het
Ece2	T	C	16: 20,618,631	L241P	probably damaging	Het
Ecel1	T	A	1: 87,151,139	Y526F	probably benign	Het
Enpp2	T	A	15: 54,870,305	R420*	probably null	Het
Epb41	A	C	4: 131,937,436		probably benign	Het
Eppin	T	C	2: 164,589,451	Y85C	probably damaging	Het
Fam171a2	G	A	11: 102,438,733	A400V	probably damaging	Het
Fam71b	G	A	11: 46,407,036	G389D	probably damaging	Het
Fem1c	A	C	18: 46,506,369	C189G	probably damaging	Het
Frmd4b	A	G	6: 97,300,314	V560A	probably benign	Het
Fsip2	A	T	2: 82,988,191	D4756V	probably damaging	Het
Gabbr1	T	C	17: 37,048,438	S102P	probably damaging	Het
Gm28042	G	A	2: 120,034,643	A250T	probably damaging	Het
Gm42877	T	C	14: 54,075,521		probably benign	Het
Gm9762	A	T	3: 78,966,400		noncoding transcript	Het
Gpr183	G	T	14: 121,954,863	T82N	possibly damaging	Het
Gps2	A	G	11: 69,914,791	K45R	probably benign	Het
Gramd2	A	G	9: 59,714,320		probably benign	Het
Grap2	G	A	15: 80,646,144	R155Q	possibly damaging	Het
Hsdl1	T	A	8: 119,565,867	Y203F	possibly damaging	Het
Ifi204	A	T	1: 173,755,668	I328N	probably damaging	Het
Igsf3	T	A	3: 101,439,361		probably null	Het
Il1rap	T	C	16: 26,624,199	I15T	probably benign	Het
Il23r	A	T	6: 67,466,316	C268S	probably damaging	Het
Irx4	A	G	13: 73,268,921	T479A	probably benign	Het
Kcnk7	G	A	19: 5,706,324	V193I	probably benign	Het
Kcnt1	G	T	2: 25,909,322		probably benign	Het
Kif13b	T	G	14: 64,757,453	C885G	probably benign	Het
Kif21b	C	A	1: 136,163,100	D1215E	probably benign	Het
Klhdc2	A	G	12: 69,296,962		probably benign	Het
Kmt2d	G	A	15: 98,847,194		probably benign	Het
Lama4	A	G	10: 39,048,054	N486S	probably benign	Het
Ldah	G	A	12: 8,227,237	A58T	probably benign	Het
Lrrc24	T	C	15: 76,716,000	Q313R	probably benign	Het
Luzp1	A	G	4: 136,543,397	D977G	possibly damaging	Het
Mrgpra4	A	G	7: 47,981,718	L45P	probably damaging	Het
Mrps28	C	T	3: 8,923,696	G34D	possibly damaging	Het
Myh8	A	G	11: 67,298,358	E1120G	probably damaging	Het
Myt1l	A	G	12: 29,832,303	E499G	unknown	Het
Ncan	C	T	8: 70,115,025	E146K	probably damaging	Het
Nlgn1	A	T	3: 25,433,794	D763E	probably damaging	Het
Olfr1259	A	T	2: 89,943,803	I104N	possibly damaging	Het
Olfr1474	C	T	19: 13,471,546	T192I	probably benign	Het
Olfr157	G	T	4: 43,836,433	A19D	probably benign	Het
Olfr23	A	T	11: 73,940,552	Y102F	possibly damaging	Het
Olfr742	T	C	14: 50,515,509	F102L	probably benign	Het
Olfr765	T	A	10: 129,046,842	I74F	possibly damaging	Het
Pak6	A	T	2: 118,694,548	I552F	probably damaging	Het
Pcbp1	G	A	6: 86,524,915	A334V	probably damaging	Het
Pclaf	T	C	9: 65,890,780	V32A	probably benign	Het
Pga5	T	A	19: 10,676,689	H50L	probably benign	Het
Phyhipl	A	T	10: 70,569,074	D56E	probably damaging	Het
Pik3ap1	C	T	19: 41,281,976	R758H	probably benign	Het
Plekha1	A	G	7: 130,905,364		probably benign	Het
Plekhm1	A	T	11: 103,387,315	N318K	possibly damaging	Het
Ppargc1b	G	A	18: 61,307,654	A731V	probably benign	Het
Pptc7	T	C	5: 122,313,781	V100A	possibly damaging	Het
Prl7a1	A	T	13: 27,633,581	H233Q	possibly damaging	Het
Prpf40a	A	G	2: 53,144,849	F776L	probably damaging	Het
Prrc2c	T	C	1: 162,705,440		probably benign	Het
Psmb1	T	C	17: 15,498,262	M1V	probably null	Het
Ptpn3	A	G	4: 57,218,513	F650S	possibly damaging	Het
Ranbp17	A	T	11: 33,404,181	*577R	probably null	Het
Reln	T	A	5: 21,971,870	N1933Y	probably benign	Het
Rgl2	T	A	17: 33,937,120	H727Q	probably benign	Het
Rhpn2	A	G	7: 35,371,124	T160A	probably damaging	Het
Rlf	G	A	4: 121,147,455	H1443Y	probably damaging	Het
Rpgrip1l	T	C	8: 91,280,816	E382G	probably damaging	Het
Rxrb	T	C	17: 34,033,588	S50P	probably benign	Het
Scn4b	A	T	9: 45,147,758	E109V	probably damaging	Het
Scrib	C	T	15: 76,051,753		probably null	Het
Slc22a29	A	T	19: 8,217,830	V147D	probably damaging	Het
Slx4	A	G	16: 4,001,199	S37P	possibly damaging	Het
Spag9	G	A	11: 94,122,722	G1127D	probably damaging	Het
Srek1	T	A	13: 103,752,556		probably benign	Het
Supt5	G	T	7: 28,316,370	P849Q	probably damaging	Het
Tex14	T	C	11: 87,433,813	S2P	probably damaging	Het
Them7	A	G	2: 105,378,808	T158A	probably benign	Het
Tldc1	A	C	8: 119,768,143	L292R	probably damaging	Het
Tll2	A	G	19: 41,130,509	V260A	possibly damaging	Het
Tlr6	A	G	5: 64,954,301	V421A	probably benign	Het
Tmc3	T	G	7: 83,615,010	C649G	probably damaging	Het
Tnn	A	G	1: 160,120,552	W864R	probably damaging	Het
Tsc2	A	C	17: 24,603,280	V1095G	probably benign	Het
Vmn1r124	C	T	7: 21,260,247	G124D	probably damaging	Het
Vmn2r116	T	C	17: 23,387,164	V350A	probably benign	Het
Vps13d	A	G	4: 145,105,898	S2813P	possibly damaging	Het
Wrap53	T	A	11: 69,563,932	M204L	possibly damaging	Het
Zfp277	A	G	12: 40,328,688	V390A	possibly damaging	Het
Zfp687	A	T	3: 95,011,676	S262T	probably benign	Het
Zfp831	T	A	2: 174,705,310	S1429T	probably benign	Het
Znfx1	G	A	2: 167,065,387		probably benign	Het

Other mutations in Slc4a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00827:Slc4a4	APN	5	89179686	missense	probably benign	0.01
IGL00976:Slc4a4	APN	5	88954798	missense	probably damaging	1.00
IGL01074:Slc4a4	APN	5	89179774	missense	probably damaging	1.00
IGL01120:Slc4a4	APN	5	89132379	missense	probably damaging	1.00
IGL01284:Slc4a4	APN	5	89129673	missense	probably benign	0.22
IGL01375:Slc4a4	APN	5	89179734	missense	probably damaging	1.00
IGL01399:Slc4a4	APN	5	89228935	missense	probably damaging	1.00
IGL01487:Slc4a4	APN	5	89228856	missense	probably benign	0.19
IGL02501:Slc4a4	APN	5	89129649	missense	probably benign	0.13
IGL03104:Slc4a4	APN	5	89149372	missense	probably damaging	1.00
IGL03157:Slc4a4	APN	5	89156513	missense	probably damaging	0.99
IGL03205:Slc4a4	APN	5	89149330	missense	probably benign	0.00
IGL03356:Slc4a4	APN	5	89122483	missense	probably benign	0.00
IGL03372:Slc4a4	APN	5	89156426	missense	probably damaging	1.00
IGL03382:Slc4a4	APN	5	89228836	missense	probably damaging	1.00
camera	UTSW	5	89132507	missense	probably damaging	1.00
pixels	UTSW	5	89122403	missense	probably damaging	0.99
Shutter	UTSW	5	89225948	missense	probably damaging	1.00
Tetrapod	UTSW	5	89228972	missense	probably damaging	1.00
tripod	UTSW	5	89149333	missense	possibly damaging	0.52
PIT4515001:Slc4a4	UTSW	5	89133253	missense	probably damaging	1.00
PIT4544001:Slc4a4	UTSW	5	89038543	missense	probably damaging	1.00
R0007:Slc4a4	UTSW	5	89038578	missense	probably damaging	1.00
R0052:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0052:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0054:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0055:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0230:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0234:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0234:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0632:Slc4a4	UTSW	5	89129641	missense	probably damaging	1.00
R1199:Slc4a4	UTSW	5	89215794	critical splice donor site	probably null
R1597:Slc4a4	UTSW	5	89135728	missense	probably benign	0.01
R1783:Slc4a4	UTSW	5	89132414	missense	probably damaging	1.00
R1813:Slc4a4	UTSW	5	89046308	missense	probably damaging	0.98
R1896:Slc4a4	UTSW	5	89046308	missense	probably damaging	0.98
R2000:Slc4a4	UTSW	5	89028347	missense	probably damaging	1.00
R2139:Slc4a4	UTSW	5	89046264	missense	probably damaging	1.00
R2163:Slc4a4	UTSW	5	89214576	missense	probably damaging	1.00
R2513:Slc4a4	UTSW	5	89156398	missense	probably benign	0.00
R2873:Slc4a4	UTSW	5	89135764	missense	probably damaging	1.00
R2995:Slc4a4	UTSW	5	88934814	missense	probably damaging	1.00
R3054:Slc4a4	UTSW	5	89225948	missense	probably damaging	1.00
R3055:Slc4a4	UTSW	5	89132507	missense	probably damaging	1.00
R3055:Slc4a4	UTSW	5	89225948	missense	probably damaging	1.00
R3056:Slc4a4	UTSW	5	89225948	missense	probably damaging	1.00
R3617:Slc4a4	UTSW	5	89234804	missense	probably benign	0.00
R3856:Slc4a4	UTSW	5	89232839	missense	probably benign	0.00
R3863:Slc4a4	UTSW	5	89135648	missense	possibly damaging	0.95
R3896:Slc4a4	UTSW	5	89197766	splice site	probably benign
R4007:Slc4a4	UTSW	5	89214593	missense	probably damaging	1.00
R4616:Slc4a4	UTSW	5	89038561	missense	probably damaging	1.00
R4740:Slc4a4	UTSW	5	89225894	missense	probably damaging	1.00
R5009:Slc4a4	UTSW	5	89149298	critical splice acceptor site	probably null
R5228:Slc4a4	UTSW	5	89156525	missense	possibly damaging	0.50
R5394:Slc4a4	UTSW	5	89197764	critical splice donor site	probably null
R5396:Slc4a4	UTSW	5	89046217	missense	probably benign	0.00
R5662:Slc4a4	UTSW	5	89028244	missense	probably damaging	0.96
R5664:Slc4a4	UTSW	5	89028244	missense	probably damaging	0.96
R6021:Slc4a4	UTSW	5	89040402	intron	probably benign
R6088:Slc4a4	UTSW	5	89197704	missense	probably benign	0.12
R6337:Slc4a4	UTSW	5	89046372	missense	probably benign	0.21
R6416:Slc4a4	UTSW	5	89179729	missense	probably benign	0.26
R6452:Slc4a4	UTSW	5	89228980	missense	probably benign	0.05
R6524:Slc4a4	UTSW	5	89232764	missense	probably benign	0.01
R6566:Slc4a4	UTSW	5	89149333	missense	possibly damaging	0.52
R6727:Slc4a4	UTSW	5	89170765	missense	probably benign	0.00
R6844:Slc4a4	UTSW	5	89228972	missense	probably damaging	1.00
R6970:Slc4a4	UTSW	5	89179831	missense	probably damaging	0.98
R7021:Slc4a4	UTSW	5	89040346	splice site	probably null
R7180:Slc4a4	UTSW	5	89046236	missense	probably damaging	0.97
R7197:Slc4a4	UTSW	5	88934574	intron	probably benign
R7246:Slc4a4	UTSW	5	89122403	missense	probably damaging	0.99
R7309:Slc4a4	UTSW	5	89170751	missense	probably benign
R7412:Slc4a4	UTSW	5	89214647	synonymous	probably null
R7492:Slc4a4	UTSW	5	89129650	missense	possibly damaging	0.92
R7561:Slc4a4	UTSW	5	89199697	missense	probably damaging	1.00
R7577:Slc4a4	UTSW	5	89225867	missense	probably damaging	0.97
R7609:Slc4a4	UTSW	5	89135686	missense	probably damaging	1.00
R7781:Slc4a4	UTSW	5	89228932	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- ATGTCACACTCACAGACTTCTC -3'
(R):5'- TTAGTCCAACCTGTCAGCAC -3'

Sequencing Primer
(F):5'- CAGACTTCTCTGGCCTGTGG -3'
(R):5'- CATATGCGTGGACATGACCCATTAG -3'

Posted On

2016-06-15