Incidental Mutation 'R5119:Mrgpra4'
ID 392817
Institutional Source Beutler Lab
Gene Symbol Mrgpra4
Ensembl Gene ENSMUSG00000067173
Gene Name MAS-related GPR, member A4
Synonyms MrgA4
MMRRC Submission 042707-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R5119 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 47630585-47631843 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 47631466 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 45 (L45P)
Ref Sequence ENSEMBL: ENSMUSP00000084327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087092]
AlphaFold Q91WW2
Predicted Effect probably damaging
Transcript: ENSMUST00000087092
AA Change: L45P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084327
Gene: ENSMUSG00000067173
AA Change: L45P

DomainStartEndE-ValueType
Pfam:7tm_1 38 270 1.3e-10 PFAM
Meta Mutation Damage Score 0.3664 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (127/127)
Allele List at MGI
Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930470P17Rik C A 2: 170,421,505 (GRCm39) G125V unknown Het
Actr6 A T 10: 89,561,717 (GRCm39) L143Q probably damaging Het
Adamts18 A G 8: 114,425,642 (GRCm39) Y1207H probably benign Het
Adamts5 T A 16: 85,696,466 (GRCm39) R230S probably benign Het
Adat2 A T 10: 13,432,650 (GRCm39) N51Y probably damaging Het
Adgrv1 T C 13: 81,567,546 (GRCm39) Y5209C possibly damaging Het
Ahnak G T 19: 8,991,008 (GRCm39) M4097I probably benign Het
Akap13 A G 7: 75,337,000 (GRCm39) T820A probably damaging Het
Als2cl C T 9: 110,719,887 (GRCm39) R492C probably damaging Het
Aox3 G A 1: 58,227,683 (GRCm39) probably null Het
Arid4b G A 13: 14,338,866 (GRCm39) V446M probably benign Het
Armc2 A G 10: 41,798,144 (GRCm39) L794P probably damaging Het
Atp6v0a1 T A 11: 100,911,341 (GRCm39) M80K probably benign Het
Aup1 T C 6: 83,032,115 (GRCm39) V94A probably damaging Het
Bank1 A T 3: 135,940,443 (GRCm39) I180K possibly damaging Het
Becn1 A G 11: 101,182,221 (GRCm39) L116P probably damaging Het
Bsg A G 10: 79,546,057 (GRCm39) probably benign Het
Camk2a A T 18: 61,076,208 (GRCm39) probably benign Het
Ccdc180 A G 4: 45,914,603 (GRCm39) E706G possibly damaging Het
Cdk8 A T 5: 146,220,437 (GRCm39) probably null Het
Cpne4 A G 9: 104,778,720 (GRCm39) probably null Het
Cspp1 T A 1: 10,196,688 (GRCm39) N900K probably damaging Het
Cyp2c38 C A 19: 39,449,065 (GRCm39) G96V probably damaging Het
Dhx40 A G 11: 86,667,462 (GRCm39) I261T probably damaging Het
Dnah10 T C 5: 124,856,322 (GRCm39) F2038L probably damaging Het
Dnah7a A T 1: 53,737,851 (GRCm39) D27E probably benign Het
Dock10 A T 1: 80,545,711 (GRCm39) probably null Het
Dst A T 1: 34,235,050 (GRCm39) K3710* probably null Het
Dtl G T 1: 191,273,618 (GRCm39) A430D probably damaging Het
Ece2 T C 16: 20,437,381 (GRCm39) L241P probably damaging Het
Ecel1 T A 1: 87,078,861 (GRCm39) Y526F probably benign Het
Enpp2 T A 15: 54,733,701 (GRCm39) R420* probably null Het
Epb41 A C 4: 131,664,747 (GRCm39) probably benign Het
Eppin T C 2: 164,431,371 (GRCm39) Y85C probably damaging Het
Fam171a2 G A 11: 102,329,559 (GRCm39) A400V probably damaging Het
Fem1c A C 18: 46,639,436 (GRCm39) C189G probably damaging Het
Frmd4b A G 6: 97,277,275 (GRCm39) V560A probably benign Het
Fsip2 A T 2: 82,818,535 (GRCm39) D4756V probably damaging Het
Gabbr1 T C 17: 37,359,330 (GRCm39) S102P probably damaging Het
Garin3 G A 11: 46,297,863 (GRCm39) G389D probably damaging Het
Gm28042 G A 2: 119,865,124 (GRCm39) A250T probably damaging Het
Gm30275 T C 14: 54,312,978 (GRCm39) probably benign Het
Gm9762 A T 3: 78,873,707 (GRCm39) noncoding transcript Het
Gpr183 G T 14: 122,192,275 (GRCm39) T82N possibly damaging Het
Gps2 A G 11: 69,805,617 (GRCm39) K45R probably benign Het
Gramd2a A G 9: 59,621,603 (GRCm39) probably benign Het
Grap2 G A 15: 80,530,345 (GRCm39) R155Q possibly damaging Het
Hsdl1 T A 8: 120,292,606 (GRCm39) Y203F possibly damaging Het
Ifi204 A T 1: 173,583,234 (GRCm39) I328N probably damaging Het
Igsf3 T A 3: 101,346,677 (GRCm39) probably null Het
Il1rap T C 16: 26,442,949 (GRCm39) I15T probably benign Het
Il23r A T 6: 67,443,300 (GRCm39) C268S probably damaging Het
Irx4 A G 13: 73,417,040 (GRCm39) T479A probably benign Het
Kcnk7 G A 19: 5,756,352 (GRCm39) V193I probably benign Het
Kcnt1 G T 2: 25,799,334 (GRCm39) probably benign Het
Kif13b T G 14: 64,994,902 (GRCm39) C885G probably benign Het
Kif21b C A 1: 136,090,838 (GRCm39) D1215E probably benign Het
Klhdc2 A G 12: 69,343,736 (GRCm39) probably benign Het
Kmt2d G A 15: 98,745,075 (GRCm39) probably benign Het
Lama4 A G 10: 38,924,050 (GRCm39) N486S probably benign Het
Ldah G A 12: 8,277,237 (GRCm39) A58T probably benign Het
Lrrc24 T C 15: 76,600,200 (GRCm39) Q313R probably benign Het
Luzp1 A G 4: 136,270,708 (GRCm39) D977G possibly damaging Het
Meak7 A C 8: 120,494,882 (GRCm39) L292R probably damaging Het
Mrps28 C T 3: 8,988,756 (GRCm39) G34D possibly damaging Het
Myh8 A G 11: 67,189,184 (GRCm39) E1120G probably damaging Het
Myt1l A G 12: 29,882,302 (GRCm39) E499G unknown Het
Ncan C T 8: 70,567,675 (GRCm39) E146K probably damaging Het
Nlgn1 A T 3: 25,487,958 (GRCm39) D763E probably damaging Het
Or11g26 T C 14: 50,752,966 (GRCm39) F102L probably benign Het
Or13c7c G T 4: 43,836,433 (GRCm39) A19D probably benign Het
Or1e17 A T 11: 73,831,378 (GRCm39) Y102F possibly damaging Het
Or4c12 A T 2: 89,774,147 (GRCm39) I104N possibly damaging Het
Or5b118 C T 19: 13,448,910 (GRCm39) T192I probably benign Het
Or6c8b T A 10: 128,882,711 (GRCm39) I74F possibly damaging Het
Pak6 A T 2: 118,525,029 (GRCm39) I552F probably damaging Het
Pcbp1 G A 6: 86,501,897 (GRCm39) A334V probably damaging Het
Pclaf T C 9: 65,798,062 (GRCm39) V32A probably benign Het
Pga5 T A 19: 10,654,053 (GRCm39) H50L probably benign Het
Phyhipl A T 10: 70,404,904 (GRCm39) D56E probably damaging Het
Pik3ap1 C T 19: 41,270,415 (GRCm39) R758H probably benign Het
Plekha1 A G 7: 130,507,094 (GRCm39) probably benign Het
Plekhm1 A T 11: 103,278,141 (GRCm39) N318K possibly damaging Het
Ppargc1b G A 18: 61,440,725 (GRCm39) A731V probably benign Het
Pptc7 T C 5: 122,451,844 (GRCm39) V100A possibly damaging Het
Prl7a1 A T 13: 27,817,564 (GRCm39) H233Q possibly damaging Het
Prpf40a A G 2: 53,034,861 (GRCm39) F776L probably damaging Het
Prrc2c T C 1: 162,533,009 (GRCm39) probably benign Het
Psmb1 T C 17: 15,718,524 (GRCm39) M1V probably null Het
Ptpn3 A G 4: 57,218,513 (GRCm39) F650S possibly damaging Het
Ranbp17 A T 11: 33,354,181 (GRCm39) *577R probably null Het
Reln T A 5: 22,176,868 (GRCm39) N1933Y probably benign Het
Rgl2 T A 17: 34,156,094 (GRCm39) H727Q probably benign Het
Rhpn2 A G 7: 35,070,549 (GRCm39) T160A probably damaging Het
Rlf G A 4: 121,004,652 (GRCm39) H1443Y probably damaging Het
Rpgrip1l T C 8: 92,007,444 (GRCm39) E382G probably damaging Het
Rxrb T C 17: 34,252,562 (GRCm39) S50P probably benign Het
Scn4b A T 9: 45,059,056 (GRCm39) E109V probably damaging Het
Scrib C T 15: 75,923,602 (GRCm39) probably null Het
Slc22a29 A T 19: 8,195,194 (GRCm39) V147D probably damaging Het
Slc4a4 A T 5: 89,102,721 (GRCm39) E53V probably null Het
Slx4 A G 16: 3,819,063 (GRCm39) S37P possibly damaging Het
Spag9 G A 11: 94,013,548 (GRCm39) G1127D probably damaging Het
Srek1 T A 13: 103,889,064 (GRCm39) probably benign Het
Supt5 G T 7: 28,015,795 (GRCm39) P849Q probably damaging Het
Tex14 T C 11: 87,324,639 (GRCm39) S2P probably damaging Het
Them7 A G 2: 105,209,153 (GRCm39) T158A probably benign Het
Tll2 A G 19: 41,118,948 (GRCm39) V260A possibly damaging Het
Tlr6 A G 5: 65,111,644 (GRCm39) V421A probably benign Het
Tmc3 T G 7: 83,264,218 (GRCm39) C649G probably damaging Het
Tnn A G 1: 159,948,122 (GRCm39) W864R probably damaging Het
Tsc2 A C 17: 24,822,254 (GRCm39) V1095G probably benign Het
Vmn1r124 C T 7: 20,994,172 (GRCm39) G124D probably damaging Het
Vmn2r116 T C 17: 23,606,138 (GRCm39) V350A probably benign Het
Vps13d A G 4: 144,832,468 (GRCm39) S2813P possibly damaging Het
Wrap53 T A 11: 69,454,758 (GRCm39) M204L possibly damaging Het
Zfp277 A G 12: 40,378,687 (GRCm39) V390A possibly damaging Het
Zfp687 A T 3: 94,918,987 (GRCm39) S262T probably benign Het
Zfp831 T A 2: 174,547,103 (GRCm39) S1429T probably benign Het
Znfx1 G A 2: 166,907,307 (GRCm39) probably benign Het
Other mutations in Mrgpra4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Mrgpra4 APN 7 47,631,052 (GRCm39) missense possibly damaging 0.54
IGL02083:Mrgpra4 APN 7 47,630,808 (GRCm39) nonsense probably null
IGL02155:Mrgpra4 APN 7 47,631,292 (GRCm39) missense probably damaging 0.99
IGL02577:Mrgpra4 APN 7 47,630,981 (GRCm39) missense probably benign 0.10
IGL02674:Mrgpra4 APN 7 47,630,690 (GRCm39) missense probably benign 0.09
IGL02696:Mrgpra4 APN 7 47,631,251 (GRCm39) missense possibly damaging 0.96
R0357:Mrgpra4 UTSW 7 47,631,574 (GRCm39) missense probably benign
R0543:Mrgpra4 UTSW 7 47,631,058 (GRCm39) missense probably benign 0.00
R0677:Mrgpra4 UTSW 7 47,630,728 (GRCm39) missense probably benign 0.00
R1163:Mrgpra4 UTSW 7 47,631,224 (GRCm39) missense probably damaging 1.00
R1217:Mrgpra4 UTSW 7 47,631,085 (GRCm39) missense probably benign 0.00
R2255:Mrgpra4 UTSW 7 47,631,523 (GRCm39) missense possibly damaging 0.70
R4191:Mrgpra4 UTSW 7 47,630,867 (GRCm39) missense probably benign 0.00
R4303:Mrgpra4 UTSW 7 47,630,684 (GRCm39) missense probably benign 0.02
R4472:Mrgpra4 UTSW 7 47,631,539 (GRCm39) missense probably benign 0.05
R4757:Mrgpra4 UTSW 7 47,630,686 (GRCm39) missense probably damaging 1.00
R4976:Mrgpra4 UTSW 7 47,631,466 (GRCm39) missense probably damaging 1.00
R5004:Mrgpra4 UTSW 7 47,631,535 (GRCm39) missense probably benign 0.26
R5034:Mrgpra4 UTSW 7 47,631,317 (GRCm39) missense probably benign 0.00
R5722:Mrgpra4 UTSW 7 47,630,755 (GRCm39) missense probably benign
R6800:Mrgpra4 UTSW 7 47,631,371 (GRCm39) missense probably damaging 1.00
R7163:Mrgpra4 UTSW 7 47,631,238 (GRCm39) missense probably benign 0.42
R7585:Mrgpra4 UTSW 7 47,631,377 (GRCm39) missense probably benign 0.24
R7636:Mrgpra4 UTSW 7 47,630,721 (GRCm39) missense possibly damaging 0.95
R8162:Mrgpra4 UTSW 7 47,631,221 (GRCm39) missense probably damaging 1.00
R8352:Mrgpra4 UTSW 7 47,631,425 (GRCm39) missense probably damaging 1.00
R8452:Mrgpra4 UTSW 7 47,631,425 (GRCm39) missense probably damaging 1.00
R8812:Mrgpra4 UTSW 7 47,631,481 (GRCm39) missense probably benign
R8996:Mrgpra4 UTSW 7 47,630,945 (GRCm39) missense probably benign 0.28
R9026:Mrgpra4 UTSW 7 47,631,208 (GRCm39) missense possibly damaging 0.73
X0028:Mrgpra4 UTSW 7 47,631,168 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGCTCAGGCCTGTGATGTAG -3'
(R):5'- AGTGAAGGCCTCATTTCTTCTTTG -3'

Sequencing Primer
(F):5'- CTCAGGCCTGTGATGTAGAGAACTG -3'
(R):5'- TTGTGTTCCCAGCAACACCAG -3'
Posted On 2016-06-15