Mutagenetix > Incidental Mutation

Incidental Mutation 'R5119:Rpgrip1l'

392823

Institutional Source

Beutler Lab

Gene Symbol

Rpgrip1l

Ensembl Gene

ENSMUSG00000033282

Gene Name

Rpgrip1-like

Synonyms

Nphp8, fantom, Ftm, 1700047E16Rik

MMRRC Submission

042707-MU

Accession Numbers

NCBI RefSeq: NM_173431.2; MGI: 1920563

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5119 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

91217030-91313262 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 91280816 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 382 (E382G)

Ref Sequence

ENSEMBL: ENSMUSP00000042702 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047783] [ENSMUST00000139113]

AlphaFold

Q8CG73

Predicted Effect

probably damaging
Transcript: ENSMUST00000047783
AA Change: E382G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000042702
Gene: ENSMUSG00000033282
AA Change: E382G

Domain	Start	End	E-Value	Type
coiled coil region	56	143	N/A	INTRINSIC
coiled coil region	196	268	N/A	INTRINSIC
coiled coil region	299	371	N/A	INTRINSIC
coiled coil region	395	454	N/A	INTRINSIC
coiled coil region	520	556	N/A	INTRINSIC
Pfam:C2-C2_1	597	738	5.8e-61	PFAM
low complexity region	769	778	N/A	INTRINSIC
C2	791	896	1.06e-5	SMART
low complexity region	989	1000	N/A	INTRINSIC
low complexity region	1057	1080	N/A	INTRINSIC
Blast:C2	1098	1223	3e-20	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136198

Predicted Effect

probably benign
Transcript: ENSMUST00000139113

SMART Domains

Protein: ENSMUSP00000118230
Gene: ENSMUSG00000033282

Domain	Start	End	E-Value	Type
coiled coil region	56	143	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211185

Meta Mutation Damage Score

0.1120

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

100% (127/127)

MGI Phenotype

Strain: 3716208
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can localize to the basal body-centrosome complex or to primary cilia and centrosomes in ciliated cells. The encoded protein has been found to interact with nephrocystin-4. Defects in this gene are a cause of Joubert syndrome type 7 (JBTS7) and Meckel syndrome type 5 (MKS5). [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for a knock-out allele do not survive after birth and show exencephaly, polydactyly, laterality defects, abnormal floor plate induction and neural tube patterning, cleft lip, micro- and anophthalmia, and variable cerebral, renal, and hepatic defects due to primary cilium dysfuntion. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock

Total: 120 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930470P17Rik	C	A	2: 170,579,585	G125V	unknown	Het
Actr6	A	T	10: 89,725,855	L143Q	probably damaging	Het
Adamts18	A	G	8: 113,699,010	Y1207H	probably benign	Het
Adamts5	T	A	16: 85,899,578	R230S	probably benign	Het
Adat2	A	T	10: 13,556,906	N51Y	probably damaging	Het
Adgrv1	T	C	13: 81,419,427	Y5209C	possibly damaging	Het
Ahnak	G	T	19: 9,013,644	M4097I	probably benign	Het
Akap13	A	G	7: 75,687,252	T820A	probably damaging	Het
Als2cl	C	T	9: 110,890,819	R492C	probably damaging	Het
Aox3	G	A	1: 58,188,524		probably null	Het
Arid4b	G	A	13: 14,164,281	V446M	probably benign	Het
Armc2	A	G	10: 41,922,148	L794P	probably damaging	Het
Atp6v0a1	T	A	11: 101,020,515	M80K	probably benign	Het
Aup1	T	C	6: 83,055,134	V94A	probably damaging	Het
Bank1	A	T	3: 136,234,682	I180K	possibly damaging	Het
Becn1	A	G	11: 101,291,395	L116P	probably damaging	Het
Bsg	A	G	10: 79,710,223		probably benign	Het
Camk2a	A	T	18: 60,943,136		probably benign	Het
Ccdc180	A	G	4: 45,914,603	E706G	possibly damaging	Het
Cdk8	A	T	5: 146,283,627		probably null	Het
Cpne4	A	G	9: 104,901,521		probably null	Het
Cspp1	T	A	1: 10,126,463	N900K	probably damaging	Het
Cyp2c38	C	A	19: 39,460,621	G96V	probably damaging	Het
Dhx40	A	G	11: 86,776,636	I261T	probably damaging	Het
Dnah10	T	C	5: 124,779,258	F2038L	probably damaging	Het
Dnah7a	A	T	1: 53,698,692	D27E	probably benign	Het
Dock10	A	T	1: 80,567,994		probably null	Het
Dst	A	T	1: 34,195,969	K3710*	probably null	Het
Dtl	G	T	1: 191,541,506	A430D	probably damaging	Het
Ece2	T	C	16: 20,618,631	L241P	probably damaging	Het
Ecel1	T	A	1: 87,151,139	Y526F	probably benign	Het
Enpp2	T	A	15: 54,870,305	R420*	probably null	Het
Epb41	A	C	4: 131,937,436		probably benign	Het
Eppin	T	C	2: 164,589,451	Y85C	probably damaging	Het
Fam171a2	G	A	11: 102,438,733	A400V	probably damaging	Het
Fam71b	G	A	11: 46,407,036	G389D	probably damaging	Het
Fem1c	A	C	18: 46,506,369	C189G	probably damaging	Het
Frmd4b	A	G	6: 97,300,314	V560A	probably benign	Het
Fsip2	A	T	2: 82,988,191	D4756V	probably damaging	Het
Gabbr1	T	C	17: 37,048,438	S102P	probably damaging	Het
Gm28042	G	A	2: 120,034,643	A250T	probably damaging	Het
Gm42877	T	C	14: 54,075,521		probably benign	Het
Gm9762	A	T	3: 78,966,400		noncoding transcript	Het
Gpr183	G	T	14: 121,954,863	T82N	possibly damaging	Het
Gps2	A	G	11: 69,914,791	K45R	probably benign	Het
Gramd2	A	G	9: 59,714,320		probably benign	Het
Grap2	G	A	15: 80,646,144	R155Q	possibly damaging	Het
Hsdl1	T	A	8: 119,565,867	Y203F	possibly damaging	Het
Ifi204	A	T	1: 173,755,668	I328N	probably damaging	Het
Igsf3	T	A	3: 101,439,361		probably null	Het
Il1rap	T	C	16: 26,624,199	I15T	probably benign	Het
Il23r	A	T	6: 67,466,316	C268S	probably damaging	Het
Irx4	A	G	13: 73,268,921	T479A	probably benign	Het
Kcnk7	G	A	19: 5,706,324	V193I	probably benign	Het
Kcnt1	G	T	2: 25,909,322		probably benign	Het
Kif13b	T	G	14: 64,757,453	C885G	probably benign	Het
Kif21b	C	A	1: 136,163,100	D1215E	probably benign	Het
Klhdc2	A	G	12: 69,296,962		probably benign	Het
Kmt2d	G	A	15: 98,847,194		probably benign	Het
Lama4	A	G	10: 39,048,054	N486S	probably benign	Het
Ldah	G	A	12: 8,227,237	A58T	probably benign	Het
Lrrc24	T	C	15: 76,716,000	Q313R	probably benign	Het
Luzp1	A	G	4: 136,543,397	D977G	possibly damaging	Het
Mrgpra4	A	G	7: 47,981,718	L45P	probably damaging	Het
Mrps28	C	T	3: 8,923,696	G34D	possibly damaging	Het
Myh8	A	G	11: 67,298,358	E1120G	probably damaging	Het
Myt1l	A	G	12: 29,832,303	E499G	unknown	Het
Ncan	C	T	8: 70,115,025	E146K	probably damaging	Het
Nlgn1	A	T	3: 25,433,794	D763E	probably damaging	Het
Olfr1259	A	T	2: 89,943,803	I104N	possibly damaging	Het
Olfr1474	C	T	19: 13,471,546	T192I	probably benign	Het
Olfr157	G	T	4: 43,836,433	A19D	probably benign	Het
Olfr23	A	T	11: 73,940,552	Y102F	possibly damaging	Het
Olfr742	T	C	14: 50,515,509	F102L	probably benign	Het
Olfr765	T	A	10: 129,046,842	I74F	possibly damaging	Het
Pak6	A	T	2: 118,694,548	I552F	probably damaging	Het
Pcbp1	G	A	6: 86,524,915	A334V	probably damaging	Het
Pclaf	T	C	9: 65,890,780	V32A	probably benign	Het
Pga5	T	A	19: 10,676,689	H50L	probably benign	Het
Phyhipl	A	T	10: 70,569,074	D56E	probably damaging	Het
Pik3ap1	C	T	19: 41,281,976	R758H	probably benign	Het
Plekha1	A	G	7: 130,905,364		probably benign	Het
Plekhm1	A	T	11: 103,387,315	N318K	possibly damaging	Het
Ppargc1b	G	A	18: 61,307,654	A731V	probably benign	Het
Pptc7	T	C	5: 122,313,781	V100A	possibly damaging	Het
Prl7a1	A	T	13: 27,633,581	H233Q	possibly damaging	Het
Prpf40a	A	G	2: 53,144,849	F776L	probably damaging	Het
Prrc2c	T	C	1: 162,705,440		probably benign	Het
Psmb1	T	C	17: 15,498,262	M1V	probably null	Het
Ptpn3	A	G	4: 57,218,513	F650S	possibly damaging	Het
Ranbp17	A	T	11: 33,404,181	*577R	probably null	Het
Reln	T	A	5: 21,971,870	N1933Y	probably benign	Het
Rgl2	T	A	17: 33,937,120	H727Q	probably benign	Het
Rhpn2	A	G	7: 35,371,124	T160A	probably damaging	Het
Rlf	G	A	4: 121,147,455	H1443Y	probably damaging	Het
Rxrb	T	C	17: 34,033,588	S50P	probably benign	Het
Scn4b	A	T	9: 45,147,758	E109V	probably damaging	Het
Scrib	C	T	15: 76,051,753		probably null	Het
Slc22a29	A	T	19: 8,217,830	V147D	probably damaging	Het
Slc4a4	A	T	5: 88,954,862	E53V	probably null	Het
Slx4	A	G	16: 4,001,199	S37P	possibly damaging	Het
Spag9	G	A	11: 94,122,722	G1127D	probably damaging	Het
Srek1	T	A	13: 103,752,556		probably benign	Het
Supt5	G	T	7: 28,316,370	P849Q	probably damaging	Het
Tex14	T	C	11: 87,433,813	S2P	probably damaging	Het
Them7	A	G	2: 105,378,808	T158A	probably benign	Het
Tldc1	A	C	8: 119,768,143	L292R	probably damaging	Het
Tll2	A	G	19: 41,130,509	V260A	possibly damaging	Het
Tlr6	A	G	5: 64,954,301	V421A	probably benign	Het
Tmc3	T	G	7: 83,615,010	C649G	probably damaging	Het
Tnn	A	G	1: 160,120,552	W864R	probably damaging	Het
Tsc2	A	C	17: 24,603,280	V1095G	probably benign	Het
Vmn1r124	C	T	7: 21,260,247	G124D	probably damaging	Het
Vmn2r116	T	C	17: 23,387,164	V350A	probably benign	Het
Vps13d	A	G	4: 145,105,898	S2813P	possibly damaging	Het
Wrap53	T	A	11: 69,563,932	M204L	possibly damaging	Het
Zfp277	A	G	12: 40,328,688	V390A	possibly damaging	Het
Zfp687	A	T	3: 95,011,676	S262T	probably benign	Het
Zfp831	T	A	2: 174,705,310	S1429T	probably benign	Het
Znfx1	G	A	2: 167,065,387		probably benign	Het

Other mutations in Rpgrip1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Rpgrip1l	APN	8	91263574	missense	possibly damaging	0.52
IGL00932:Rpgrip1l	APN	8	91275637	missense	probably benign	0.33
IGL01113:Rpgrip1l	APN	8	91260739	intron	probably benign
IGL01151:Rpgrip1l	APN	8	91275149	missense	probably damaging	1.00
IGL01321:Rpgrip1l	APN	8	91260873	nonsense	probably null
IGL01384:Rpgrip1l	APN	8	91273640	missense	probably benign	0.00
IGL01634:Rpgrip1l	APN	8	91252543	missense	probably benign
IGL01634:Rpgrip1l	APN	8	91252544	missense	probably benign	0.25
IGL01781:Rpgrip1l	APN	8	91270218	missense	probably benign	0.16
IGL01784:Rpgrip1l	APN	8	91270461	missense	possibly damaging	0.56
IGL02034:Rpgrip1l	APN	8	91251148	critical splice donor site	probably null
IGL02250:Rpgrip1l	APN	8	91232861	missense	probably benign	0.00
IGL02285:Rpgrip1l	APN	8	91232907	missense	possibly damaging	0.92
IGL02634:Rpgrip1l	APN	8	91225344	splice site	probably benign
IGL02736:Rpgrip1l	APN	8	91263591	missense	possibly damaging	0.91
IGL02825:Rpgrip1l	APN	8	91304805	missense	possibly damaging	0.67
IGL02962:Rpgrip1l	APN	8	91270362	missense	possibly damaging	0.95
IGL03031:Rpgrip1l	APN	8	91260783	missense	probably damaging	1.00
IGL03184:Rpgrip1l	APN	8	91300809	missense	probably damaging	1.00
P0005:Rpgrip1l	UTSW	8	91299225	splice site	probably benign
R0118:Rpgrip1l	UTSW	8	91270122	missense	probably damaging	1.00
R0490:Rpgrip1l	UTSW	8	91299845	splice site	probably benign
R0599:Rpgrip1l	UTSW	8	91305000	missense	probably damaging	1.00
R1514:Rpgrip1l	UTSW	8	91260750	missense	probably damaging	1.00
R1648:Rpgrip1l	UTSW	8	91252889	missense	probably damaging	1.00
R1914:Rpgrip1l	UTSW	8	91232924	missense	probably benign	0.13
R1915:Rpgrip1l	UTSW	8	91232924	missense	probably benign	0.13
R2093:Rpgrip1l	UTSW	8	91270132	missense	possibly damaging	0.87
R2225:Rpgrip1l	UTSW	8	91221467	missense	probably benign	0.45
R2504:Rpgrip1l	UTSW	8	91280716	critical splice donor site	probably null
R3859:Rpgrip1l	UTSW	8	91263658	missense	probably benign	0.00
R4118:Rpgrip1l	UTSW	8	91252907	missense	probably benign
R4801:Rpgrip1l	UTSW	8	91270177	missense	probably damaging	1.00
R4802:Rpgrip1l	UTSW	8	91270177	missense	probably damaging	1.00
R4921:Rpgrip1l	UTSW	8	91261009	missense	probably benign	0.05
R4976:Rpgrip1l	UTSW	8	91280816	missense	probably damaging	1.00
R5092:Rpgrip1l	UTSW	8	91221384	nonsense	probably null
R5099:Rpgrip1l	UTSW	8	91248722	missense	probably benign	0.20
R5141:Rpgrip1l	UTSW	8	91260918	missense	probably benign	0.29
R5793:Rpgrip1l	UTSW	8	91260772	missense	probably benign	0.06
R5847:Rpgrip1l	UTSW	8	91304985	missense	probably damaging	1.00
R5871:Rpgrip1l	UTSW	8	91221386	missense	possibly damaging	0.89
R5916:Rpgrip1l	UTSW	8	91252913	missense	possibly damaging	0.93
R6619:Rpgrip1l	UTSW	8	91232871	missense	possibly damaging	0.69
R6654:Rpgrip1l	UTSW	8	91220205	missense	probably benign	0.36
R6956:Rpgrip1l	UTSW	8	91286313	splice site	probably null
R6984:Rpgrip1l	UTSW	8	91260798	missense	probably benign	0.03
R7064:Rpgrip1l	UTSW	8	91263520	nonsense	probably null
R7145:Rpgrip1l	UTSW	8	91232806	critical splice donor site	probably null
R7243:Rpgrip1l	UTSW	8	91270123	missense	probably benign	0.00
R7673:Rpgrip1l	UTSW	8	91300787	missense	possibly damaging	0.89
R7796:Rpgrip1l	UTSW	8	91270237	missense	probably damaging	1.00
R8684:Rpgrip1l	UTSW	8	91273701	missense	probably benign	0.00
R8769:Rpgrip1l	UTSW	8	91252584	splice site	probably benign
R8955:Rpgrip1l	UTSW	8	91280828	missense	possibly damaging	0.67
R9006:Rpgrip1l	UTSW	8	91280808	missense	probably benign
R9085:Rpgrip1l	UTSW	8	91287675	missense	possibly damaging	0.68
R9188:Rpgrip1l	UTSW	8	91305010	missense	probably damaging	1.00
R9258:Rpgrip1l	UTSW	8	91260986	nonsense	probably null
R9268:Rpgrip1l	UTSW	8	91280727	missense	probably benign
R9366:Rpgrip1l	UTSW	8	91270181	nonsense	probably null
R9547:Rpgrip1l	UTSW	8	91251245	missense	probably benign	0.00
R9565:Rpgrip1l	UTSW	8	91304888	missense	probably benign	0.05
R9582:Rpgrip1l	UTSW	8	91270258	missense	probably benign	0.03
R9604:Rpgrip1l	UTSW	8	91304805	missense	possibly damaging	0.67
R9614:Rpgrip1l	UTSW	8	91260806	missense	possibly damaging	0.79
R9697:Rpgrip1l	UTSW	8	91260763	missense	possibly damaging	0.49
Z1088:Rpgrip1l	UTSW	8	91220179	makesense	probably null
Z1088:Rpgrip1l	UTSW	8	91260975	missense	possibly damaging	0.96
Z1088:Rpgrip1l	UTSW	8	91270120	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- GGGAATCTGAGAAACAATTCTTTTGGC -3'
(R):5'- GTTTCAACAGCAGCAGACCAG -3'

Sequencing Primer
(F):5'- ACTGCTTTGTCCCCAGAGG -3'
(R):5'- GCAGCAGACCAGCATATGTTTAC -3'

Posted On

2016-06-15