Mutagenetix > Incidental Mutation

Incidental Mutation 'R5119:Dhx40'

392845

Institutional Source

Beutler Lab

Gene Symbol

Dhx40

Ensembl Gene

ENSMUSG00000018425

Gene Name

DEAH (Asp-Glu-Ala-His) box polypeptide 40

Synonyms

ARG147, 2410016C14Rik, DDX40

MMRRC Submission

042707-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5119 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86768846-86807746 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 86776636 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 261 (I261T)

Ref Sequence

ENSEMBL: ENSMUSP00000114918 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018569] [ENSMUST00000148263]

AlphaFold

Q6PE54

Predicted Effect

possibly damaging
Transcript: ENSMUST00000018569
AA Change: I559T

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000018569
Gene: ENSMUSG00000018425
AA Change: I559T

Domain	Start	End	E-Value	Type
DEXDc	47	240	6.32e-33	SMART
HELICc	283	401	3.08e-13	SMART
HA2	462	557	1.92e-21	SMART
Pfam:OB_NTP_bind	588	699	1.7e-20	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000148263
AA Change: I261T

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000114918
Gene: ENSMUSG00000018425
AA Change: I261T

Domain	Start	End	E-Value	Type
Blast:DEXDc	1	96	3e-60	BLAST
SCOP:d1a1va1	4	59	5e-7	SMART
HA2	164	259	1.92e-21	SMART

Meta Mutation Damage Score

0.8610

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

100% (127/127)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DExH/D box family of ATP-dependent RNA helicases that have an essential role in RNA metabolism. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 17.[provided by RefSeq, Oct 2009]

Allele List at MGI

Other mutations in this stock

Total: 120 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930470P17Rik	C	A	2: 170,579,585	G125V	unknown	Het
Actr6	A	T	10: 89,725,855	L143Q	probably damaging	Het
Adamts18	A	G	8: 113,699,010	Y1207H	probably benign	Het
Adamts5	T	A	16: 85,899,578	R230S	probably benign	Het
Adat2	A	T	10: 13,556,906	N51Y	probably damaging	Het
Adgrv1	T	C	13: 81,419,427	Y5209C	possibly damaging	Het
Ahnak	G	T	19: 9,013,644	M4097I	probably benign	Het
Akap13	A	G	7: 75,687,252	T820A	probably damaging	Het
Als2cl	C	T	9: 110,890,819	R492C	probably damaging	Het
Aox3	G	A	1: 58,188,524		probably null	Het
Arid4b	G	A	13: 14,164,281	V446M	probably benign	Het
Armc2	A	G	10: 41,922,148	L794P	probably damaging	Het
Atp6v0a1	T	A	11: 101,020,515	M80K	probably benign	Het
Aup1	T	C	6: 83,055,134	V94A	probably damaging	Het
Bank1	A	T	3: 136,234,682	I180K	possibly damaging	Het
Becn1	A	G	11: 101,291,395	L116P	probably damaging	Het
Bsg	A	G	10: 79,710,223		probably benign	Het
Camk2a	A	T	18: 60,943,136		probably benign	Het
Ccdc180	A	G	4: 45,914,603	E706G	possibly damaging	Het
Cdk8	A	T	5: 146,283,627		probably null	Het
Cpne4	A	G	9: 104,901,521		probably null	Het
Cspp1	T	A	1: 10,126,463	N900K	probably damaging	Het
Cyp2c38	C	A	19: 39,460,621	G96V	probably damaging	Het
Dnah10	T	C	5: 124,779,258	F2038L	probably damaging	Het
Dnah7a	A	T	1: 53,698,692	D27E	probably benign	Het
Dock10	A	T	1: 80,567,994		probably null	Het
Dst	A	T	1: 34,195,969	K3710*	probably null	Het
Dtl	G	T	1: 191,541,506	A430D	probably damaging	Het
Ece2	T	C	16: 20,618,631	L241P	probably damaging	Het
Ecel1	T	A	1: 87,151,139	Y526F	probably benign	Het
Enpp2	T	A	15: 54,870,305	R420*	probably null	Het
Epb41	A	C	4: 131,937,436		probably benign	Het
Eppin	T	C	2: 164,589,451	Y85C	probably damaging	Het
Fam171a2	G	A	11: 102,438,733	A400V	probably damaging	Het
Fam71b	G	A	11: 46,407,036	G389D	probably damaging	Het
Fem1c	A	C	18: 46,506,369	C189G	probably damaging	Het
Frmd4b	A	G	6: 97,300,314	V560A	probably benign	Het
Fsip2	A	T	2: 82,988,191	D4756V	probably damaging	Het
Gabbr1	T	C	17: 37,048,438	S102P	probably damaging	Het
Gm28042	G	A	2: 120,034,643	A250T	probably damaging	Het
Gm42877	T	C	14: 54,075,521		probably benign	Het
Gm9762	A	T	3: 78,966,400		noncoding transcript	Het
Gpr183	G	T	14: 121,954,863	T82N	possibly damaging	Het
Gps2	A	G	11: 69,914,791	K45R	probably benign	Het
Gramd2	A	G	9: 59,714,320		probably benign	Het
Grap2	G	A	15: 80,646,144	R155Q	possibly damaging	Het
Hsdl1	T	A	8: 119,565,867	Y203F	possibly damaging	Het
Ifi204	A	T	1: 173,755,668	I328N	probably damaging	Het
Igsf3	T	A	3: 101,439,361		probably null	Het
Il1rap	T	C	16: 26,624,199	I15T	probably benign	Het
Il23r	A	T	6: 67,466,316	C268S	probably damaging	Het
Irx4	A	G	13: 73,268,921	T479A	probably benign	Het
Kcnk7	G	A	19: 5,706,324	V193I	probably benign	Het
Kcnt1	G	T	2: 25,909,322		probably benign	Het
Kif13b	T	G	14: 64,757,453	C885G	probably benign	Het
Kif21b	C	A	1: 136,163,100	D1215E	probably benign	Het
Klhdc2	A	G	12: 69,296,962		probably benign	Het
Kmt2d	G	A	15: 98,847,194		probably benign	Het
Lama4	A	G	10: 39,048,054	N486S	probably benign	Het
Ldah	G	A	12: 8,227,237	A58T	probably benign	Het
Lrrc24	T	C	15: 76,716,000	Q313R	probably benign	Het
Luzp1	A	G	4: 136,543,397	D977G	possibly damaging	Het
Mrgpra4	A	G	7: 47,981,718	L45P	probably damaging	Het
Mrps28	C	T	3: 8,923,696	G34D	possibly damaging	Het
Myh8	A	G	11: 67,298,358	E1120G	probably damaging	Het
Myt1l	A	G	12: 29,832,303	E499G	unknown	Het
Ncan	C	T	8: 70,115,025	E146K	probably damaging	Het
Nlgn1	A	T	3: 25,433,794	D763E	probably damaging	Het
Olfr1259	A	T	2: 89,943,803	I104N	possibly damaging	Het
Olfr1474	C	T	19: 13,471,546	T192I	probably benign	Het
Olfr157	G	T	4: 43,836,433	A19D	probably benign	Het
Olfr23	A	T	11: 73,940,552	Y102F	possibly damaging	Het
Olfr742	T	C	14: 50,515,509	F102L	probably benign	Het
Olfr765	T	A	10: 129,046,842	I74F	possibly damaging	Het
Pak6	A	T	2: 118,694,548	I552F	probably damaging	Het
Pcbp1	G	A	6: 86,524,915	A334V	probably damaging	Het
Pclaf	T	C	9: 65,890,780	V32A	probably benign	Het
Pga5	T	A	19: 10,676,689	H50L	probably benign	Het
Phyhipl	A	T	10: 70,569,074	D56E	probably damaging	Het
Pik3ap1	C	T	19: 41,281,976	R758H	probably benign	Het
Plekha1	A	G	7: 130,905,364		probably benign	Het
Plekhm1	A	T	11: 103,387,315	N318K	possibly damaging	Het
Ppargc1b	G	A	18: 61,307,654	A731V	probably benign	Het
Pptc7	T	C	5: 122,313,781	V100A	possibly damaging	Het
Prl7a1	A	T	13: 27,633,581	H233Q	possibly damaging	Het
Prpf40a	A	G	2: 53,144,849	F776L	probably damaging	Het
Prrc2c	T	C	1: 162,705,440		probably benign	Het
Psmb1	T	C	17: 15,498,262	M1V	probably null	Het
Ptpn3	A	G	4: 57,218,513	F650S	possibly damaging	Het
Ranbp17	A	T	11: 33,404,181	*577R	probably null	Het
Reln	T	A	5: 21,971,870	N1933Y	probably benign	Het
Rgl2	T	A	17: 33,937,120	H727Q	probably benign	Het
Rhpn2	A	G	7: 35,371,124	T160A	probably damaging	Het
Rlf	G	A	4: 121,147,455	H1443Y	probably damaging	Het
Rpgrip1l	T	C	8: 91,280,816	E382G	probably damaging	Het
Rxrb	T	C	17: 34,033,588	S50P	probably benign	Het
Scn4b	A	T	9: 45,147,758	E109V	probably damaging	Het
Scrib	C	T	15: 76,051,753		probably null	Het
Slc22a29	A	T	19: 8,217,830	V147D	probably damaging	Het
Slc4a4	A	T	5: 88,954,862	E53V	probably null	Het
Slx4	A	G	16: 4,001,199	S37P	possibly damaging	Het
Spag9	G	A	11: 94,122,722	G1127D	probably damaging	Het
Srek1	T	A	13: 103,752,556		probably benign	Het
Supt5	G	T	7: 28,316,370	P849Q	probably damaging	Het
Tex14	T	C	11: 87,433,813	S2P	probably damaging	Het
Them7	A	G	2: 105,378,808	T158A	probably benign	Het
Tldc1	A	C	8: 119,768,143	L292R	probably damaging	Het
Tll2	A	G	19: 41,130,509	V260A	possibly damaging	Het
Tlr6	A	G	5: 64,954,301	V421A	probably benign	Het
Tmc3	T	G	7: 83,615,010	C649G	probably damaging	Het
Tnn	A	G	1: 160,120,552	W864R	probably damaging	Het
Tsc2	A	C	17: 24,603,280	V1095G	probably benign	Het
Vmn1r124	C	T	7: 21,260,247	G124D	probably damaging	Het
Vmn2r116	T	C	17: 23,387,164	V350A	probably benign	Het
Vps13d	A	G	4: 145,105,898	S2813P	possibly damaging	Het
Wrap53	T	A	11: 69,563,932	M204L	possibly damaging	Het
Zfp277	A	G	12: 40,328,688	V390A	possibly damaging	Het
Zfp687	A	T	3: 95,011,676	S262T	probably benign	Het
Zfp831	T	A	2: 174,705,310	S1429T	probably benign	Het
Znfx1	G	A	2: 167,065,387		probably benign	Het

Other mutations in Dhx40

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02366:Dhx40	APN	11	86776702	missense	probably damaging	0.98
IGL02818:Dhx40	APN	11	86799505	missense	probably benign	0.26
IGL02932:Dhx40	APN	11	86771929	missense	probably damaging	1.00
R0312:Dhx40	UTSW	11	86771949	missense	probably damaging	0.99
R0485:Dhx40	UTSW	11	86771262	unclassified	probably benign
R0542:Dhx40	UTSW	11	86804256	critical splice donor site	probably null
R0565:Dhx40	UTSW	11	86771167	missense	probably damaging	0.97
R1218:Dhx40	UTSW	11	86799484	missense	probably benign	0.13
R1406:Dhx40	UTSW	11	86797745	missense	probably benign	0.01
R1406:Dhx40	UTSW	11	86797745	missense	probably benign	0.01
R1544:Dhx40	UTSW	11	86806553	missense	possibly damaging	0.93
R1550:Dhx40	UTSW	11	86776739	splice site	probably null
R1839:Dhx40	UTSW	11	86789297	missense	possibly damaging	0.46
R2923:Dhx40	UTSW	11	86789263	missense	probably benign	0.26
R3743:Dhx40	UTSW	11	86771159	missense	probably damaging	0.99
R3864:Dhx40	UTSW	11	86789245	missense	possibly damaging	0.85
R4902:Dhx40	UTSW	11	86771210	missense	possibly damaging	0.95
R4918:Dhx40	UTSW	11	86804391	missense	possibly damaging	0.85
R5416:Dhx40	UTSW	11	86797691	missense	probably benign	0.01
R5531:Dhx40	UTSW	11	86789504	missense	possibly damaging	0.45
R5677:Dhx40	UTSW	11	86800963	splice site	probably null
R6270:Dhx40	UTSW	11	86799605	missense	possibly damaging	0.85
R6431:Dhx40	UTSW	11	86773823	missense	probably damaging	0.97
R6456:Dhx40	UTSW	11	86784974	missense	probably damaging	1.00
R6594:Dhx40	UTSW	11	86785773	missense	possibly damaging	0.74
R6599:Dhx40	UTSW	11	86804349	missense	possibly damaging	0.51
R7069:Dhx40	UTSW	11	86797743	missense	probably benign	0.06
R7268:Dhx40	UTSW	11	86806616	missense	possibly damaging	0.86
R7470:Dhx40	UTSW	11	86776702	missense	probably damaging	0.98
R7632:Dhx40	UTSW	11	86799437	missense	probably benign	0.42
R7728:Dhx40	UTSW	11	86771933	missense	probably damaging	0.98
R7788:Dhx40	UTSW	11	86775676	missense	possibly damaging	0.86
R7869:Dhx40	UTSW	11	86797706	missense	probably benign	0.02
R7889:Dhx40	UTSW	11	86798967	missense	probably benign	0.01
R8046:Dhx40	UTSW	11	86784940	nonsense	probably null
R8380:Dhx40	UTSW	11	86806585	missense	probably damaging	1.00
R8691:Dhx40	UTSW	11	86799593	missense	possibly damaging	0.63
R8992:Dhx40	UTSW	11	86776756	intron	probably benign
R9153:Dhx40	UTSW	11	86799539	missense	probably damaging	0.97
R9157:Dhx40	UTSW	11	86771224	missense	probably damaging	0.98
R9277:Dhx40	UTSW	11	86770230	missense	probably benign	0.33
X0021:Dhx40	UTSW	11	86773814	missense	possibly damaging	0.84
X0066:Dhx40	UTSW	11	86806502	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- GCAGAGATCTGGACAAGCAC -3'
(R):5'- GCAGCTGTTGTTGAACATGG -3'

Sequencing Primer
(F):5'- ACTCTAGTTCTAGGGGATCCAATGC -3'
(R):5'- CAGCTGTTGTTGAACATGGTGGAAG -3'

Posted On

2016-06-15