Incidental Mutation 'R0443:Itga1'
ID39287
Institutional Source Beutler Lab
Gene Symbol Itga1
Ensembl Gene ENSMUSG00000042284
Gene Nameintegrin alpha 1
SynonymsCD49A, Vla1, E130012M19Rik
MMRRC Submission 038644-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.489) question?
Stock #R0443 (G1)
Quality Score225
Status Validated (trace)
Chromosome13
Chromosomal Location114953096-115101964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 114992460 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 554 (D554V)
Ref Sequence ENSEMBL: ENSMUSP00000077132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061673]
Predicted Effect probably benign
Transcript: ENSMUST00000061673
AA Change: D554V

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000077132
Gene: ENSMUSG00000042284
AA Change: D554V

DomainStartEndE-ValueType
Int_alpha 43 96 1.63e0 SMART
VWA 170 360 4.24e-44 SMART
Int_alpha 432 481 4.21e-3 SMART
Int_alpha 485 542 3.19e-12 SMART
Int_alpha 566 621 1.79e-15 SMART
Int_alpha 628 682 3.04e1 SMART
low complexity region 1108 1122 N/A INTRINSIC
PDB:2L8S|A 1135 1179 5e-10 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224865
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha 1 subunit of integrin receptors. This protein heterodimerizes with the beta 1 subunit to form a cell-surface receptor for collagen and laminin. The heterodimeric receptor is involved in cell-cell adhesion and may play a role in inflammation and fibrosis. The alpha 1 subunit contains an inserted (I) von Willebrand factor type I domain which is thought to be involved in collagen binding. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are essentially normal although their kidneys are smaller and more succeptible to injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3b G T 5: 25,848,411 R246L probably damaging Het
Adam18 T C 8: 24,629,637 probably null Het
Ankhd1 A G 18: 36,644,599 S1612G possibly damaging Het
Caskin1 C T 17: 24,505,400 A1054V probably damaging Het
Casz1 T C 4: 148,948,911 V1380A possibly damaging Het
Cnot6l T G 5: 96,091,745 probably benign Het
Crat T C 2: 30,403,628 probably benign Het
Ctgf T C 10: 24,595,803 probably benign Het
Cux2 C T 5: 121,887,437 R56H possibly damaging Het
Dst A G 1: 34,294,550 probably null Het
Dync2h1 G T 9: 7,167,244 probably null Het
Epg5 T C 18: 77,955,903 probably benign Het
Ergic3 G A 2: 156,016,787 V278M probably benign Het
Fam20b A T 1: 156,681,453 D396E probably benign Het
Gapvd1 A G 2: 34,704,621 probably benign Het
Golga1 A T 2: 39,018,441 S749T probably damaging Het
Gsdma2 C T 11: 98,657,688 T255I probably damaging Het
Itgam C T 7: 128,081,634 A245V probably damaging Het
Kcnk15 A G 2: 163,858,323 T161A probably benign Het
Map3k19 A T 1: 127,822,415 N1066K probably benign Het
Ms4a6b A G 19: 11,521,680 I53V possibly damaging Het
Mtf1 C T 4: 124,824,282 probably benign Het
Neb T C 2: 52,161,477 probably null Het
Nop9 A G 14: 55,753,748 S621G probably benign Het
Olfr378 A G 11: 73,425,755 V76A probably damaging Het
Olfr459 T A 6: 41,771,895 I135F possibly damaging Het
Olfr484 A G 7: 108,124,816 V149A probably benign Het
Pacs1 A T 19: 5,272,583 Y102* probably null Het
Pcdhb10 A C 18: 37,412,432 D187A probably damaging Het
Pih1d2 A G 9: 50,621,103 R170G possibly damaging Het
Pikfyve A G 1: 65,196,706 H179R probably damaging Het
Pknox1 A G 17: 31,592,219 S156G probably damaging Het
Prkcz T A 4: 155,269,140 D250V probably damaging Het
Psg16 T A 7: 17,095,163 I224N probably benign Het
Slc25a40 T A 5: 8,447,348 S229T probably benign Het
Slc43a2 T C 11: 75,544,667 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tas2r129 G T 6: 132,951,196 C32F probably benign Het
Tfap2d C T 1: 19,104,367 R15C possibly damaging Het
Tonsl T C 15: 76,639,684 S39G probably benign Het
Trove2 A G 1: 143,765,923 probably benign Het
Trpc2 A G 7: 102,093,520 probably benign Het
Ttc17 A G 2: 94,378,094 F144S probably benign Het
Twnk G T 19: 45,008,139 G337V possibly damaging Het
Uvssa A G 5: 33,388,824 R180G possibly damaging Het
Vmn1r197 T A 13: 22,328,071 I54K possibly damaging Het
Vmn1r71 G A 7: 10,748,311 T84I probably benign Het
Zbtb49 T C 5: 38,200,830 E693G probably benign Het
Other mutations in Itga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Itga1 APN 13 114992363 missense possibly damaging 0.80
IGL00498:Itga1 APN 13 115031193 missense probably benign 0.00
IGL00549:Itga1 APN 13 115049296 missense possibly damaging 0.92
IGL00587:Itga1 APN 13 115012249 missense probably damaging 1.00
IGL01021:Itga1 APN 13 114997000 missense probably benign 0.29
IGL01289:Itga1 APN 13 114986226 missense possibly damaging 0.79
IGL01636:Itga1 APN 13 115006948 missense possibly damaging 0.73
IGL01791:Itga1 APN 13 114987661 missense probably benign 0.00
IGL01796:Itga1 APN 13 114985121 missense probably damaging 1.00
IGL02027:Itga1 APN 13 114990055 splice site probably null
IGL02330:Itga1 APN 13 115012204 missense probably damaging 1.00
IGL02480:Itga1 APN 13 114987648 missense probably damaging 1.00
IGL02943:Itga1 APN 13 115049296 missense possibly damaging 0.92
R0103:Itga1 UTSW 13 115016254 missense probably benign 0.40
R0103:Itga1 UTSW 13 115016254 missense probably benign 0.40
R0244:Itga1 UTSW 13 115006897 splice site probably benign
R0265:Itga1 UTSW 13 114992459 missense probably benign
R0302:Itga1 UTSW 13 115012318 splice site probably benign
R0320:Itga1 UTSW 13 114977594 splice site probably benign
R0389:Itga1 UTSW 13 114992460 missense probably benign 0.04
R0574:Itga1 UTSW 13 114966561 missense probably damaging 1.00
R0646:Itga1 UTSW 13 114968299 missense probably benign
R0830:Itga1 UTSW 13 115007032 missense probably benign 0.08
R2162:Itga1 UTSW 13 115030910 missense probably benign 0.23
R2216:Itga1 UTSW 13 114997029 missense probably benign 0.00
R2403:Itga1 UTSW 13 114977614 missense probably benign 0.00
R3734:Itga1 UTSW 13 114977639 missense probably benign
R4171:Itga1 UTSW 13 115030886 nonsense probably null
R4402:Itga1 UTSW 13 115001566 missense probably benign 0.00
R4675:Itga1 UTSW 13 115001691 splice site probably null
R4684:Itga1 UTSW 13 115049370 missense probably damaging 1.00
R4795:Itga1 UTSW 13 115035385 missense probably damaging 1.00
R4796:Itga1 UTSW 13 115035385 missense probably damaging 1.00
R4845:Itga1 UTSW 13 114974172 nonsense probably null
R5147:Itga1 UTSW 13 114985142 missense possibly damaging 0.91
R5155:Itga1 UTSW 13 115035303 missense probably benign
R5234:Itga1 UTSW 13 115049303 nonsense probably null
R5344:Itga1 UTSW 13 115002309 missense possibly damaging 0.78
R5554:Itga1 UTSW 13 114992474 nonsense probably null
R5662:Itga1 UTSW 13 114986171 missense probably benign 0.03
R5945:Itga1 UTSW 13 114966590 missense probably benign 0.02
R6150:Itga1 UTSW 13 114968233 missense probably benign 0.01
R6241:Itga1 UTSW 13 114960137 splice site probably null
R6276:Itga1 UTSW 13 114980852 missense probably benign
R6369:Itga1 UTSW 13 114965660 missense probably damaging 1.00
R6511:Itga1 UTSW 13 114992501 missense probably damaging 0.98
R6663:Itga1 UTSW 13 114974105 missense probably benign 0.02
R6783:Itga1 UTSW 13 114996977 missense probably benign 0.22
R6931:Itga1 UTSW 13 115001563 missense probably benign 0.39
R7069:Itga1 UTSW 13 114968240 missense probably damaging 1.00
R7458:Itga1 UTSW 13 114986266 missense probably benign 0.00
R7588:Itga1 UTSW 13 114968249 missense possibly damaging 0.88
R7591:Itga1 UTSW 13 114982779 missense probably damaging 1.00
R7597:Itga1 UTSW 13 114974140 missense probably benign 0.28
R7615:Itga1 UTSW 13 114996922 missense probably null 0.99
R7756:Itga1 UTSW 13 114992460 missense probably benign 0.04
R7795:Itga1 UTSW 13 115012236 missense probably damaging 1.00
R7819:Itga1 UTSW 13 115049301 missense probably damaging 0.99
Z1177:Itga1 UTSW 13 114985071 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTTAAAGAGCAAGACAGGTGAGCCC -3'
(R):5'- ACTTCATAAGGTTGGCGAGACGTG -3'

Sequencing Primer
(F):5'- GGCCCTCAAGAAATCTTGGTG -3'
(R):5'- TGCACTTAAAAAACAAACCTACGC -3'
Posted On2013-05-23