Incidental Mutation 'R5119:Rgl2'
ID 392875
Institutional Source Beutler Lab
Gene Symbol Rgl2
Ensembl Gene ENSMUSG00000041354
Gene Name ral guanine nucleotide dissociation stimulator-like 2
Synonyms Rlf, Rgt2, Rab2l, KE1.5
MMRRC Submission 042707-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.136) question?
Stock # R5119 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 34148813-34156661 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 34156094 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 727 (H727Q)
Ref Sequence ENSEMBL: ENSMUSP00000041082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025163] [ENSMUST00000025170] [ENSMUST00000047503] [ENSMUST00000173363] [ENSMUST00000174426] [ENSMUST00000174048] [ENSMUST00000179418]
AlphaFold Q61193
PDB Structure STRUCTURE DETERMINATION OF THE RAS-BINDING DOMAIN OF THE RAL-SPECIFIC GUANINE NUCLEOTIDE EXCHANGE FACTOR RLF, NMR, 10 STRUCTURES [SOLUTION NMR]
The conformation of a docking site for SH3 domains is pre-selected in the Guanine Nucleotide Exchange Factor Rlf [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025163
SMART Domains Protein: ENSMUSP00000025163
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 9.6e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025170
SMART Domains Protein: ENSMUSP00000025170
Gene: ENSMUSG00000024312

DomainStartEndE-ValueType
coiled coil region 126 155 N/A INTRINSIC
low complexity region 204 217 N/A INTRINSIC
WD40 225 262 1.02e2 SMART
WD40 267 302 3.3e1 SMART
Blast:WD40 305 344 8e-19 BLAST
WD40 347 386 9.52e-6 SMART
Blast:WD40 392 426 3e-14 BLAST
BING4CT 439 517 8.85e-53 SMART
low complexity region 542 556 N/A INTRINSIC
low complexity region 586 593 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047503
AA Change: H727Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354
AA Change: H727Q

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 44 63 N/A INTRINSIC
RasGEFN 87 212 9.54e-30 SMART
RasGEF 239 514 7.15e-106 SMART
low complexity region 578 592 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
RA 649 736 2.05e-19 SMART
low complexity region 737 762 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173266
Predicted Effect unknown
Transcript: ENSMUST00000173284
AA Change: H279Q
SMART Domains Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354
AA Change: H279Q

DomainStartEndE-ValueType
Blast:RasGEF 2 67 1e-35 BLAST
PDB:4JGW|B 2 67 1e-35 PDB
SCOP:d1bkds_ 2 94 3e-16 SMART
low complexity region 131 145 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
RA 202 289 2.05e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173363
SMART Domains Protein: ENSMUSP00000138662
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 1 89 1.1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174442
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173678
Predicted Effect probably benign
Transcript: ENSMUST00000174426
SMART Domains Protein: ENSMUSP00000134069
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 1 89 1.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174048
SMART Domains Protein: ENSMUSP00000133656
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179418
SMART Domains Protein: ENSMUSP00000137072
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 2e-28 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (127/127)
Allele List at MGI
Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930470P17Rik C A 2: 170,421,505 (GRCm39) G125V unknown Het
Actr6 A T 10: 89,561,717 (GRCm39) L143Q probably damaging Het
Adamts18 A G 8: 114,425,642 (GRCm39) Y1207H probably benign Het
Adamts5 T A 16: 85,696,466 (GRCm39) R230S probably benign Het
Adat2 A T 10: 13,432,650 (GRCm39) N51Y probably damaging Het
Adgrv1 T C 13: 81,567,546 (GRCm39) Y5209C possibly damaging Het
Ahnak G T 19: 8,991,008 (GRCm39) M4097I probably benign Het
Akap13 A G 7: 75,337,000 (GRCm39) T820A probably damaging Het
Als2cl C T 9: 110,719,887 (GRCm39) R492C probably damaging Het
Aox3 G A 1: 58,227,683 (GRCm39) probably null Het
Arid4b G A 13: 14,338,866 (GRCm39) V446M probably benign Het
Armc2 A G 10: 41,798,144 (GRCm39) L794P probably damaging Het
Atp6v0a1 T A 11: 100,911,341 (GRCm39) M80K probably benign Het
Aup1 T C 6: 83,032,115 (GRCm39) V94A probably damaging Het
Bank1 A T 3: 135,940,443 (GRCm39) I180K possibly damaging Het
Becn1 A G 11: 101,182,221 (GRCm39) L116P probably damaging Het
Bsg A G 10: 79,546,057 (GRCm39) probably benign Het
Camk2a A T 18: 61,076,208 (GRCm39) probably benign Het
Ccdc180 A G 4: 45,914,603 (GRCm39) E706G possibly damaging Het
Cdk8 A T 5: 146,220,437 (GRCm39) probably null Het
Cpne4 A G 9: 104,778,720 (GRCm39) probably null Het
Cspp1 T A 1: 10,196,688 (GRCm39) N900K probably damaging Het
Cyp2c38 C A 19: 39,449,065 (GRCm39) G96V probably damaging Het
Dhx40 A G 11: 86,667,462 (GRCm39) I261T probably damaging Het
Dnah10 T C 5: 124,856,322 (GRCm39) F2038L probably damaging Het
Dnah7a A T 1: 53,737,851 (GRCm39) D27E probably benign Het
Dock10 A T 1: 80,545,711 (GRCm39) probably null Het
Dst A T 1: 34,235,050 (GRCm39) K3710* probably null Het
Dtl G T 1: 191,273,618 (GRCm39) A430D probably damaging Het
Ece2 T C 16: 20,437,381 (GRCm39) L241P probably damaging Het
Ecel1 T A 1: 87,078,861 (GRCm39) Y526F probably benign Het
Enpp2 T A 15: 54,733,701 (GRCm39) R420* probably null Het
Epb41 A C 4: 131,664,747 (GRCm39) probably benign Het
Eppin T C 2: 164,431,371 (GRCm39) Y85C probably damaging Het
Fam171a2 G A 11: 102,329,559 (GRCm39) A400V probably damaging Het
Fem1c A C 18: 46,639,436 (GRCm39) C189G probably damaging Het
Frmd4b A G 6: 97,277,275 (GRCm39) V560A probably benign Het
Fsip2 A T 2: 82,818,535 (GRCm39) D4756V probably damaging Het
Gabbr1 T C 17: 37,359,330 (GRCm39) S102P probably damaging Het
Garin3 G A 11: 46,297,863 (GRCm39) G389D probably damaging Het
Gm28042 G A 2: 119,865,124 (GRCm39) A250T probably damaging Het
Gm30275 T C 14: 54,312,978 (GRCm39) probably benign Het
Gm9762 A T 3: 78,873,707 (GRCm39) noncoding transcript Het
Gpr183 G T 14: 122,192,275 (GRCm39) T82N possibly damaging Het
Gps2 A G 11: 69,805,617 (GRCm39) K45R probably benign Het
Gramd2a A G 9: 59,621,603 (GRCm39) probably benign Het
Grap2 G A 15: 80,530,345 (GRCm39) R155Q possibly damaging Het
Hsdl1 T A 8: 120,292,606 (GRCm39) Y203F possibly damaging Het
Ifi204 A T 1: 173,583,234 (GRCm39) I328N probably damaging Het
Igsf3 T A 3: 101,346,677 (GRCm39) probably null Het
Il1rap T C 16: 26,442,949 (GRCm39) I15T probably benign Het
Il23r A T 6: 67,443,300 (GRCm39) C268S probably damaging Het
Irx4 A G 13: 73,417,040 (GRCm39) T479A probably benign Het
Kcnk7 G A 19: 5,756,352 (GRCm39) V193I probably benign Het
Kcnt1 G T 2: 25,799,334 (GRCm39) probably benign Het
Kif13b T G 14: 64,994,902 (GRCm39) C885G probably benign Het
Kif21b C A 1: 136,090,838 (GRCm39) D1215E probably benign Het
Klhdc2 A G 12: 69,343,736 (GRCm39) probably benign Het
Kmt2d G A 15: 98,745,075 (GRCm39) probably benign Het
Lama4 A G 10: 38,924,050 (GRCm39) N486S probably benign Het
Ldah G A 12: 8,277,237 (GRCm39) A58T probably benign Het
Lrrc24 T C 15: 76,600,200 (GRCm39) Q313R probably benign Het
Luzp1 A G 4: 136,270,708 (GRCm39) D977G possibly damaging Het
Meak7 A C 8: 120,494,882 (GRCm39) L292R probably damaging Het
Mrgpra4 A G 7: 47,631,466 (GRCm39) L45P probably damaging Het
Mrps28 C T 3: 8,988,756 (GRCm39) G34D possibly damaging Het
Myh8 A G 11: 67,189,184 (GRCm39) E1120G probably damaging Het
Myt1l A G 12: 29,882,302 (GRCm39) E499G unknown Het
Ncan C T 8: 70,567,675 (GRCm39) E146K probably damaging Het
Nlgn1 A T 3: 25,487,958 (GRCm39) D763E probably damaging Het
Or11g26 T C 14: 50,752,966 (GRCm39) F102L probably benign Het
Or13c7c G T 4: 43,836,433 (GRCm39) A19D probably benign Het
Or1e17 A T 11: 73,831,378 (GRCm39) Y102F possibly damaging Het
Or4c12 A T 2: 89,774,147 (GRCm39) I104N possibly damaging Het
Or5b118 C T 19: 13,448,910 (GRCm39) T192I probably benign Het
Or6c8b T A 10: 128,882,711 (GRCm39) I74F possibly damaging Het
Pak6 A T 2: 118,525,029 (GRCm39) I552F probably damaging Het
Pcbp1 G A 6: 86,501,897 (GRCm39) A334V probably damaging Het
Pclaf T C 9: 65,798,062 (GRCm39) V32A probably benign Het
Pga5 T A 19: 10,654,053 (GRCm39) H50L probably benign Het
Phyhipl A T 10: 70,404,904 (GRCm39) D56E probably damaging Het
Pik3ap1 C T 19: 41,270,415 (GRCm39) R758H probably benign Het
Plekha1 A G 7: 130,507,094 (GRCm39) probably benign Het
Plekhm1 A T 11: 103,278,141 (GRCm39) N318K possibly damaging Het
Ppargc1b G A 18: 61,440,725 (GRCm39) A731V probably benign Het
Pptc7 T C 5: 122,451,844 (GRCm39) V100A possibly damaging Het
Prl7a1 A T 13: 27,817,564 (GRCm39) H233Q possibly damaging Het
Prpf40a A G 2: 53,034,861 (GRCm39) F776L probably damaging Het
Prrc2c T C 1: 162,533,009 (GRCm39) probably benign Het
Psmb1 T C 17: 15,718,524 (GRCm39) M1V probably null Het
Ptpn3 A G 4: 57,218,513 (GRCm39) F650S possibly damaging Het
Ranbp17 A T 11: 33,354,181 (GRCm39) *577R probably null Het
Reln T A 5: 22,176,868 (GRCm39) N1933Y probably benign Het
Rhpn2 A G 7: 35,070,549 (GRCm39) T160A probably damaging Het
Rlf G A 4: 121,004,652 (GRCm39) H1443Y probably damaging Het
Rpgrip1l T C 8: 92,007,444 (GRCm39) E382G probably damaging Het
Rxrb T C 17: 34,252,562 (GRCm39) S50P probably benign Het
Scn4b A T 9: 45,059,056 (GRCm39) E109V probably damaging Het
Scrib C T 15: 75,923,602 (GRCm39) probably null Het
Slc22a29 A T 19: 8,195,194 (GRCm39) V147D probably damaging Het
Slc4a4 A T 5: 89,102,721 (GRCm39) E53V probably null Het
Slx4 A G 16: 3,819,063 (GRCm39) S37P possibly damaging Het
Spag9 G A 11: 94,013,548 (GRCm39) G1127D probably damaging Het
Srek1 T A 13: 103,889,064 (GRCm39) probably benign Het
Supt5 G T 7: 28,015,795 (GRCm39) P849Q probably damaging Het
Tex14 T C 11: 87,324,639 (GRCm39) S2P probably damaging Het
Them7 A G 2: 105,209,153 (GRCm39) T158A probably benign Het
Tll2 A G 19: 41,118,948 (GRCm39) V260A possibly damaging Het
Tlr6 A G 5: 65,111,644 (GRCm39) V421A probably benign Het
Tmc3 T G 7: 83,264,218 (GRCm39) C649G probably damaging Het
Tnn A G 1: 159,948,122 (GRCm39) W864R probably damaging Het
Tsc2 A C 17: 24,822,254 (GRCm39) V1095G probably benign Het
Vmn1r124 C T 7: 20,994,172 (GRCm39) G124D probably damaging Het
Vmn2r116 T C 17: 23,606,138 (GRCm39) V350A probably benign Het
Vps13d A G 4: 144,832,468 (GRCm39) S2813P possibly damaging Het
Wrap53 T A 11: 69,454,758 (GRCm39) M204L possibly damaging Het
Zfp277 A G 12: 40,378,687 (GRCm39) V390A possibly damaging Het
Zfp687 A T 3: 94,918,987 (GRCm39) S262T probably benign Het
Zfp831 T A 2: 174,547,103 (GRCm39) S1429T probably benign Het
Znfx1 G A 2: 166,907,307 (GRCm39) probably benign Het
Other mutations in Rgl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Rgl2 APN 17 34,152,110 (GRCm39) missense probably benign 0.31
IGL00898:Rgl2 APN 17 34,152,392 (GRCm39) missense possibly damaging 0.95
IGL00965:Rgl2 APN 17 34,154,910 (GRCm39) missense probably benign 0.00
IGL00985:Rgl2 APN 17 34,151,075 (GRCm39) missense probably damaging 1.00
IGL02140:Rgl2 APN 17 34,152,098 (GRCm39) missense probably damaging 1.00
IGL02214:Rgl2 APN 17 34,154,163 (GRCm39) missense probably benign 0.06
IGL02486:Rgl2 APN 17 34,154,954 (GRCm39) missense probably damaging 0.97
IGL02579:Rgl2 APN 17 34,156,134 (GRCm39) missense probably benign 0.08
IGL02976:Rgl2 APN 17 34,152,936 (GRCm39) missense possibly damaging 0.95
Hypotenuse UTSW 17 34,150,713 (GRCm39) missense probably benign 0.00
Pedernales UTSW 17 34,151,012 (GRCm39) critical splice acceptor site probably null
PIT4354001:Rgl2 UTSW 17 34,152,914 (GRCm39) missense possibly damaging 0.80
R0347:Rgl2 UTSW 17 34,151,712 (GRCm39) missense probably damaging 1.00
R0456:Rgl2 UTSW 17 34,155,823 (GRCm39) splice site probably null
R0825:Rgl2 UTSW 17 34,154,133 (GRCm39) splice site probably null
R1742:Rgl2 UTSW 17 34,156,197 (GRCm39) splice site probably null
R1777:Rgl2 UTSW 17 34,150,718 (GRCm39) missense probably benign 0.00
R1829:Rgl2 UTSW 17 34,152,595 (GRCm39) missense probably benign 0.00
R1908:Rgl2 UTSW 17 34,151,122 (GRCm39) missense probably benign 0.00
R1961:Rgl2 UTSW 17 34,152,589 (GRCm39) missense probably damaging 1.00
R2102:Rgl2 UTSW 17 34,152,314 (GRCm39) splice site probably null
R3001:Rgl2 UTSW 17 34,151,579 (GRCm39) missense probably benign 0.00
R3002:Rgl2 UTSW 17 34,151,579 (GRCm39) missense probably benign 0.00
R3755:Rgl2 UTSW 17 34,151,571 (GRCm39) missense probably benign 0.01
R3756:Rgl2 UTSW 17 34,151,571 (GRCm39) missense probably benign 0.01
R3978:Rgl2 UTSW 17 34,154,136 (GRCm39) missense probably benign 0.02
R4042:Rgl2 UTSW 17 34,156,236 (GRCm39) missense probably damaging 1.00
R4064:Rgl2 UTSW 17 34,156,082 (GRCm39) missense possibly damaging 0.77
R4204:Rgl2 UTSW 17 34,155,906 (GRCm39) missense probably benign 0.04
R4661:Rgl2 UTSW 17 34,152,200 (GRCm39) missense possibly damaging 0.77
R4852:Rgl2 UTSW 17 34,156,147 (GRCm39) missense probably benign 0.00
R4922:Rgl2 UTSW 17 34,151,749 (GRCm39) unclassified probably benign
R5167:Rgl2 UTSW 17 34,154,948 (GRCm39) nonsense probably null
R5279:Rgl2 UTSW 17 34,154,922 (GRCm39) missense probably benign
R5319:Rgl2 UTSW 17 34,152,529 (GRCm39) missense probably benign 0.02
R5337:Rgl2 UTSW 17 34,153,958 (GRCm39) missense probably damaging 0.99
R5881:Rgl2 UTSW 17 34,151,691 (GRCm39) missense probably benign 0.01
R5945:Rgl2 UTSW 17 34,151,012 (GRCm39) critical splice acceptor site probably null
R6165:Rgl2 UTSW 17 34,150,739 (GRCm39) missense probably benign 0.01
R6358:Rgl2 UTSW 17 34,156,105 (GRCm39) splice site probably null
R6867:Rgl2 UTSW 17 34,151,661 (GRCm39) missense probably benign 0.09
R7174:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7182:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7183:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7184:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7196:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7203:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7250:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7253:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7254:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7255:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7256:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7282:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7455:Rgl2 UTSW 17 34,151,657 (GRCm39) missense probably benign 0.32
R7513:Rgl2 UTSW 17 34,151,529 (GRCm39) missense probably benign
R7752:Rgl2 UTSW 17 34,154,799 (GRCm39) missense possibly damaging 0.82
R7901:Rgl2 UTSW 17 34,154,799 (GRCm39) missense possibly damaging 0.82
R7941:Rgl2 UTSW 17 34,150,713 (GRCm39) missense probably benign 0.00
R8158:Rgl2 UTSW 17 34,155,918 (GRCm39) missense probably benign 0.27
R8209:Rgl2 UTSW 17 34,151,501 (GRCm39) missense possibly damaging 0.91
R8226:Rgl2 UTSW 17 34,151,501 (GRCm39) missense possibly damaging 0.91
R8405:Rgl2 UTSW 17 34,152,698 (GRCm39) nonsense probably null
R8871:Rgl2 UTSW 17 34,153,974 (GRCm39) missense probably damaging 1.00
R9205:Rgl2 UTSW 17 34,155,002 (GRCm39) missense probably damaging 1.00
R9591:Rgl2 UTSW 17 34,151,451 (GRCm39) missense possibly damaging 0.50
X0028:Rgl2 UTSW 17 34,151,432 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- AATCGTGATTCTGCTGTGGC -3'
(R):5'- ACTCCTGGTATGAGTTGCTATG -3'

Sequencing Primer
(F):5'- CAGAGTTCGAGCTGGTGCAG -3'
(R):5'- CCTGGTATGAGTTGCTATGTAAACC -3'
Posted On 2016-06-15