Incidental Mutation 'R0443:Nop9'
ID39288
Institutional Source Beutler Lab
Gene Symbol Nop9
Ensembl Gene ENSMUSG00000019297
Gene NameNOP9 nucleolar protein
Synonyms
MMRRC Submission 038644-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R0443 (G1)
Quality Score225
Status Validated (trace)
Chromosome14
Chromosomal Location55745693-55755500 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55753748 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 621 (S621G)
Ref Sequence ENSEMBL: ENSMUSP00000019441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001497] [ENSMUST00000019441]
Predicted Effect probably benign
Transcript: ENSMUST00000001497
SMART Domains Protein: ENSMUSP00000001497
Gene: ENSMUSG00000022219

DomainStartEndE-ValueType
CAD 36 108 2.16e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000019441
AA Change: S621G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000019441
Gene: ENSMUSG00000019297
AA Change: S621G

DomainStartEndE-ValueType
low complexity region 11 55 N/A INTRINSIC
Blast:Pumilio 92 127 3e-15 BLAST
Pumilio 189 220 2.74e2 SMART
Blast:Pumilio 263 298 3e-14 BLAST
Pumilio 314 349 4.38e1 SMART
Pumilio 351 387 1.03e1 SMART
Pumilio 509 546 1.72e1 SMART
Pumilio 547 582 9.17e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136270
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227300
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3b G T 5: 25,848,411 R246L probably damaging Het
Adam18 T C 8: 24,629,637 probably null Het
Ankhd1 A G 18: 36,644,599 S1612G possibly damaging Het
Caskin1 C T 17: 24,505,400 A1054V probably damaging Het
Casz1 T C 4: 148,948,911 V1380A possibly damaging Het
Cnot6l T G 5: 96,091,745 probably benign Het
Crat T C 2: 30,403,628 probably benign Het
Ctgf T C 10: 24,595,803 probably benign Het
Cux2 C T 5: 121,887,437 R56H possibly damaging Het
Dst A G 1: 34,294,550 probably null Het
Dync2h1 G T 9: 7,167,244 probably null Het
Epg5 T C 18: 77,955,903 probably benign Het
Ergic3 G A 2: 156,016,787 V278M probably benign Het
Fam20b A T 1: 156,681,453 D396E probably benign Het
Gapvd1 A G 2: 34,704,621 probably benign Het
Golga1 A T 2: 39,018,441 S749T probably damaging Het
Gsdma2 C T 11: 98,657,688 T255I probably damaging Het
Itga1 T A 13: 114,992,460 D554V probably benign Het
Itgam C T 7: 128,081,634 A245V probably damaging Het
Kcnk15 A G 2: 163,858,323 T161A probably benign Het
Map3k19 A T 1: 127,822,415 N1066K probably benign Het
Ms4a6b A G 19: 11,521,680 I53V possibly damaging Het
Mtf1 C T 4: 124,824,282 probably benign Het
Neb T C 2: 52,161,477 probably null Het
Olfr378 A G 11: 73,425,755 V76A probably damaging Het
Olfr459 T A 6: 41,771,895 I135F possibly damaging Het
Olfr484 A G 7: 108,124,816 V149A probably benign Het
Pacs1 A T 19: 5,272,583 Y102* probably null Het
Pcdhb10 A C 18: 37,412,432 D187A probably damaging Het
Pih1d2 A G 9: 50,621,103 R170G possibly damaging Het
Pikfyve A G 1: 65,196,706 H179R probably damaging Het
Pknox1 A G 17: 31,592,219 S156G probably damaging Het
Prkcz T A 4: 155,269,140 D250V probably damaging Het
Psg16 T A 7: 17,095,163 I224N probably benign Het
Slc25a40 T A 5: 8,447,348 S229T probably benign Het
Slc43a2 T C 11: 75,544,667 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tas2r129 G T 6: 132,951,196 C32F probably benign Het
Tfap2d C T 1: 19,104,367 R15C possibly damaging Het
Tonsl T C 15: 76,639,684 S39G probably benign Het
Trove2 A G 1: 143,765,923 probably benign Het
Trpc2 A G 7: 102,093,520 probably benign Het
Ttc17 A G 2: 94,378,094 F144S probably benign Het
Twnk G T 19: 45,008,139 G337V possibly damaging Het
Uvssa A G 5: 33,388,824 R180G possibly damaging Het
Vmn1r197 T A 13: 22,328,071 I54K possibly damaging Het
Vmn1r71 G A 7: 10,748,311 T84I probably benign Het
Zbtb49 T C 5: 38,200,830 E693G probably benign Het
Other mutations in Nop9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02156:Nop9 APN 14 55753283 nonsense probably null
IGL02803:Nop9 APN 14 55750076 missense probably benign
R1766:Nop9 UTSW 14 55752134 missense possibly damaging 0.94
R1785:Nop9 UTSW 14 55751142 missense probably damaging 1.00
R1786:Nop9 UTSW 14 55751142 missense probably damaging 1.00
R3015:Nop9 UTSW 14 55751174 missense probably benign 0.00
R4784:Nop9 UTSW 14 55746402 small deletion probably benign
R5046:Nop9 UTSW 14 55745940 missense possibly damaging 0.90
R5787:Nop9 UTSW 14 55746334 missense possibly damaging 0.93
R6271:Nop9 UTSW 14 55753741 missense probably damaging 1.00
R6379:Nop9 UTSW 14 55745792 missense possibly damaging 0.83
R6943:Nop9 UTSW 14 55752813 missense probably benign 0.25
R7562:Nop9 UTSW 14 55749352 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCTTCTGTACCCGGTAGCTGATTG -3'
(R):5'- TTACTGACGCCTACCCCTAAGATCC -3'

Sequencing Primer
(F):5'- GAAAATGGATGGCCCTTTACCTC -3'
(R):5'- tcttgatattcttgttttaccctctg -3'
Posted On2013-05-23