Incidental Mutation 'R5120:Pak7'
ID392900
Institutional Source Beutler Lab
Gene Symbol Pak7
Ensembl Gene ENSMUSG00000039913
Gene Namep21 (RAC1) activated kinase 7
Synonyms2900083L08Rik, Pak5
MMRRC Submission 042708-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5120 (G1)
Quality Score205
Status Validated
Chromosome2
Chromosomal Location136081104-136387967 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 136083229 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 718 (H718Y)
Ref Sequence ENSEMBL: ENSMUSP00000076440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035264] [ENSMUST00000077200]
Predicted Effect probably damaging
Transcript: ENSMUST00000035264
AA Change: H718Y

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000047285
Gene: ENSMUSG00000039913
AA Change: H718Y

DomainStartEndE-ValueType
PBD 11 46 5.3e-13 SMART
low complexity region 394 415 N/A INTRINSIC
S_TKc 449 700 1.39e-90 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077200
AA Change: H718Y

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000076440
Gene: ENSMUSG00000039913
AA Change: H718Y

DomainStartEndE-ValueType
PBD 11 46 5.3e-13 SMART
low complexity region 394 415 N/A INTRINSIC
S_TKc 449 700 1.39e-90 SMART
Meta Mutation Damage Score 0.1162 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.6%
Validation Efficiency 100% (97/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PAK family of Ser/Thr protein kinases. PAK family members are known to be effectors of Rac/Cdc42 GTPases, which have been implicated in the regulation of cytoskeletal dynamics, proliferation, and cell survival signaling. This kinase contains a CDC42/Rac1 interactive binding (CRIB) motif, and has been shown to bind CDC42 in the presence of GTP. This kinase is predominantly expressed in brain. It is capable of promoting neurite outgrowth, and thus may play a role in neurite development. This kinase is associated with microtubule networks and induces microtubule stabilization. The subcellular localization of this kinase is tightly regulated during cell cycle progression. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit impaired active avoidance learning but are otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,210,235 H225R probably benign Het
Abcc9 T A 6: 142,656,618 I690F probably benign Het
Acp4 A T 7: 44,256,971 D52E probably damaging Het
Adam17 T C 12: 21,343,019 probably benign Het
Adamts15 T C 9: 30,921,576 E221G probably damaging Het
Aoc2 A G 11: 101,325,714 T208A probably benign Het
Apoa4 T G 9: 46,242,737 I212S probably damaging Het
Bptf A T 11: 107,073,385 M1598K probably damaging Het
Camsap3 G A 8: 3,600,680 R209Q probably damaging Het
Ccdc171 C A 4: 83,558,526 probably benign Het
Celsr2 G C 3: 108,393,120 P2875A probably benign Het
Cenpb A G 2: 131,179,818 V20A probably benign Het
Cfap61 A T 2: 146,143,160 K975* probably null Het
Col9a2 G T 4: 121,039,772 A20S unknown Het
Crnn A T 3: 93,148,896 I330F probably benign Het
Csf3r C A 4: 126,035,827 P381Q probably benign Het
Csmd3 G A 15: 48,673,495 Q104* probably null Het
Ctnna1 G A 18: 35,182,554 probably null Het
Cwf19l2 C T 9: 3,418,761 Q183* probably null Het
Ddx60 T C 8: 61,945,906 Y220H probably benign Het
Dhh T C 15: 98,898,157 Q39R probably benign Het
Dynlrb2 T A 8: 116,515,698 I89N possibly damaging Het
Dytn T C 1: 63,623,043 E645G probably benign Het
Efcab7 A G 4: 99,897,491 T287A probably damaging Het
Eogt A G 6: 97,134,315 V195A probably benign Het
Ep400 G T 5: 110,756,358 P125Q probably damaging Het
Fasn A G 11: 120,811,391 V1815A probably benign Het
Gm4788 T C 1: 139,753,103 S226G probably benign Het
Gm5866 T C 5: 52,582,882 noncoding transcript Het
Gm8674 C A 13: 49,901,948 noncoding transcript Het
Gpat4 G T 8: 23,180,202 H270Q possibly damaging Het
Grik5 A G 7: 25,010,640 L890P probably damaging Het
Gsap A G 5: 21,269,936 N500S probably damaging Het
H2-M10.1 T C 17: 36,325,156 D173G probably benign Het
Igfn1 T A 1: 135,973,502 I413F possibly damaging Het
Ighv1-52 G T 12: 115,145,786 H17N probably benign Het
Kcnu1 T A 8: 25,934,488 D270E possibly damaging Het
Kif16b A C 2: 142,848,339 N274K probably damaging Het
Klk1b11 C T 7: 43,999,022 T151I probably benign Het
Krtap13 A G 16: 88,751,570 F10S probably damaging Het
Large1 A T 8: 72,859,341 I379N probably damaging Het
Lhx8 T C 3: 154,311,695 H301R probably damaging Het
Lrriq3 T C 3: 155,129,384 V252A probably benign Het
Lysmd3 T A 13: 81,669,192 I96N probably damaging Het
Mpeg1 C T 19: 12,461,429 Q84* probably null Het
Myoz1 C T 14: 20,650,654 G165D probably benign Het
Myt1 G A 2: 181,797,620 V312I probably benign Het
Ndufb7 T C 8: 83,566,977 probably benign Het
Numa1 C T 7: 101,977,437 T10M probably damaging Het
Olfr1285 T C 2: 111,409,240 noncoding transcript Het
Olfr130 A T 17: 38,067,266 I32F probably damaging Het
Olfr1316 A T 2: 112,130,558 D84E probably damaging Het
Olfr149 T A 9: 39,702,070 H233L probably benign Het
Olfr390 A C 11: 73,786,964 I9L probably benign Het
Osmr A T 15: 6,827,275 S464T probably benign Het
Pan2 T A 10: 128,314,995 probably null Het
Pik3r4 T C 9: 105,669,009 S853P probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Polr3gl T A 3: 96,578,479 probably benign Het
Psd2 G A 18: 35,979,810 R186Q possibly damaging Het
Psd4 T C 2: 24,405,438 V868A probably benign Het
Ralgapa2 G T 2: 146,412,084 T852K probably benign Het
Rbm43 T C 2: 51,932,423 probably benign Het
Rps6kl1 C A 12: 85,139,348 G329C probably damaging Het
Scaf11 T C 15: 96,419,542 T714A probably benign Het
Selenoo C A 15: 89,094,305 N310K possibly damaging Het
Sepsecs T C 5: 52,660,661 Q258R probably damaging Het
Sgcz T C 8: 37,526,266 S226G probably benign Het
Slfn5 A G 11: 82,960,928 K627E probably damaging Het
Sos1 A T 17: 80,408,248 F1027I probably damaging Het
Ssh1 C G 5: 113,957,398 V228L possibly damaging Het
Sugp1 C A 8: 70,048,667 P65T probably benign Het
Tas2r106 T A 6: 131,678,816 N24I probably damaging Het
Tex10 T C 4: 48,459,272 E534G possibly damaging Het
Tmem182 C T 1: 40,854,901 T192I possibly damaging Het
Traf7 T A 17: 24,518,744 K51* probably null Het
Trap1 C A 16: 4,044,088 R604L probably damaging Het
Trim6 T A 7: 104,228,240 L179Q probably damaging Het
Ubfd1 T C 7: 122,071,750 S264P probably damaging Het
Upk3bl T C 5: 136,064,191 probably benign Het
Wdfy3 T A 5: 101,868,106 Q2601L possibly damaging Het
Wdr89 A G 12: 75,632,638 Y281H probably damaging Het
Zfp286 A T 11: 62,780,725 M174K probably benign Het
Zmym1 T C 4: 127,051,437 probably null Het
Other mutations in Pak7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01671:Pak7 APN 2 136116373 missense possibly damaging 0.89
IGL01743:Pak7 APN 2 136087413 missense probably damaging 1.00
IGL02601:Pak7 APN 2 136116935 nonsense probably null
IGL03172:Pak7 APN 2 136098390 nonsense probably null
currency UTSW 2 136100939 missense probably benign 0.15
Depreciation UTSW 2 136097534 missense probably damaging 1.00
PIT4498001:Pak7 UTSW 2 136083291 missense probably damaging 1.00
R0025:Pak7 UTSW 2 136100784 missense possibly damaging 0.68
R0025:Pak7 UTSW 2 136100784 missense possibly damaging 0.68
R0400:Pak7 UTSW 2 136097579 missense possibly damaging 0.95
R0441:Pak7 UTSW 2 136116629 missense probably benign
R1653:Pak7 UTSW 2 136116887 missense probably damaging 1.00
R1662:Pak7 UTSW 2 136116760 missense probably damaging 0.96
R1855:Pak7 UTSW 2 136087509 missense probably benign 0.00
R1872:Pak7 UTSW 2 136085588 missense possibly damaging 0.93
R2001:Pak7 UTSW 2 136116637 missense probably benign 0.00
R2002:Pak7 UTSW 2 136116637 missense probably benign 0.00
R2157:Pak7 UTSW 2 136100957 missense probably damaging 0.96
R2160:Pak7 UTSW 2 136098382 missense probably benign 0.01
R2217:Pak7 UTSW 2 136116203 missense probably damaging 1.00
R3797:Pak7 UTSW 2 136100826 missense probably benign 0.06
R4711:Pak7 UTSW 2 136087517 missense probably damaging 1.00
R4904:Pak7 UTSW 2 136083347 missense probably benign 0.02
R5090:Pak7 UTSW 2 136087418 missense probably damaging 1.00
R5669:Pak7 UTSW 2 136116284 missense probably damaging 1.00
R5954:Pak7 UTSW 2 136116463 missense probably benign 0.01
R6127:Pak7 UTSW 2 136087406 missense probably damaging 0.99
R6250:Pak7 UTSW 2 136174269 start gained probably benign
R6471:Pak7 UTSW 2 136116190 missense probably benign 0.00
R6797:Pak7 UTSW 2 136097534 missense probably damaging 1.00
R6809:Pak7 UTSW 2 136097581 missense possibly damaging 0.83
R6945:Pak7 UTSW 2 136100939 missense probably benign 0.15
R7254:Pak7 UTSW 2 136116764 missense possibly damaging 0.50
R7265:Pak7 UTSW 2 136101185 missense probably benign 0.03
R7335:Pak7 UTSW 2 136098299 missense probably damaging 1.00
R7511:Pak7 UTSW 2 136083324 missense possibly damaging 0.87
R7573:Pak7 UTSW 2 136116305 missense probably damaging 1.00
R7593:Pak7 UTSW 2 136100964 missense probably benign 0.40
R7908:Pak7 UTSW 2 136116559 missense probably benign 0.14
R8304:Pak7 UTSW 2 136098283 missense probably benign 0.11
Z1176:Pak7 UTSW 2 136083246 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTAGAAGATGCCCTGGTCTG -3'
(R):5'- TAGTTGGGGCATCATTTCAGGAC -3'

Sequencing Primer
(F):5'- AAGATGCCCTGGTCTGTCGAAC -3'
(R):5'- ATCATTTCAGGACAGTGGGCC -3'
Posted On2016-06-15