Incidental Mutation 'R5120:Col9a2'
ID 392911
Institutional Source Beutler Lab
Gene Symbol Col9a2
Ensembl Gene ENSMUSG00000028626
Gene Name collagen, type IX, alpha 2
Synonyms Col9a-2
MMRRC Submission 042708-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5120 (G1)
Quality Score 174
Status Validated
Chromosome 4
Chromosomal Location 120896763-120912522 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 120896969 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 20 (A20S)
Ref Sequence ENSEMBL: ENSMUSP00000030372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030372]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000030372
AA Change: A20S
SMART Domains Protein: ENSMUSP00000030372
Gene: ENSMUSG00000028626
AA Change: A20S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Collagen 24 82 7.3e-12 PFAM
Pfam:Collagen 59 115 2.4e-10 PFAM
Pfam:Collagen 113 170 2e-8 PFAM
Pfam:Collagen 176 236 8.9e-11 PFAM
low complexity region 258 277 N/A INTRINSIC
low complexity region 288 315 N/A INTRINSIC
Pfam:Collagen 357 435 4.4e-8 PFAM
Pfam:Collagen 459 523 6.1e-11 PFAM
Pfam:Collagen 548 610 4.5e-11 PFAM
low complexity region 639 661 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151987
Meta Mutation Damage Score 0.0758 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.6%
Validation Efficiency 100% (97/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. This chain is unusual in that, unlike the other two type IX alpha chains, it contains a covalently attached glycosaminoglycan side chain. Mutations in this gene are associated with multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,101,061 (GRCm39) H225R probably benign Het
Abcc9 T A 6: 142,602,344 (GRCm39) I690F probably benign Het
Acp4 A T 7: 43,906,395 (GRCm39) D52E probably damaging Het
Adam17 T C 12: 21,393,020 (GRCm39) probably benign Het
Adamts15 T C 9: 30,832,872 (GRCm39) E221G probably damaging Het
Aoc2 A G 11: 101,216,540 (GRCm39) T208A probably benign Het
Apoa4 T G 9: 46,154,035 (GRCm39) I212S probably damaging Het
Bptf A T 11: 106,964,211 (GRCm39) M1598K probably damaging Het
Camsap3 G A 8: 3,650,680 (GRCm39) R209Q probably damaging Het
Ccdc171 C A 4: 83,476,763 (GRCm39) probably benign Het
Celsr2 G C 3: 108,300,436 (GRCm39) P2875A probably benign Het
Cenpb A G 2: 131,021,738 (GRCm39) V20A probably benign Het
Cfap61 A T 2: 145,985,080 (GRCm39) K975* probably null Het
Cfhr4 T C 1: 139,680,841 (GRCm39) S226G probably benign Het
Crnn A T 3: 93,056,203 (GRCm39) I330F probably benign Het
Csf3r C A 4: 125,929,620 (GRCm39) P381Q probably benign Het
Csmd3 G A 15: 48,536,891 (GRCm39) Q104* probably null Het
Ctnna1 G A 18: 35,315,607 (GRCm39) probably null Het
Cwf19l2 C T 9: 3,418,761 (GRCm39) Q183* probably null Het
Ddx60 T C 8: 62,398,940 (GRCm39) Y220H probably benign Het
Dhh T C 15: 98,796,038 (GRCm39) Q39R probably benign Het
Dynlrb2 T A 8: 117,242,437 (GRCm39) I89N possibly damaging Het
Dytn T C 1: 63,662,202 (GRCm39) E645G probably benign Het
Efcab7 A G 4: 99,754,688 (GRCm39) T287A probably damaging Het
Eogt A G 6: 97,111,276 (GRCm39) V195A probably benign Het
Ep400 G T 5: 110,904,224 (GRCm39) P125Q probably damaging Het
Fasn A G 11: 120,702,217 (GRCm39) V1815A probably benign Het
Gm5866 T C 5: 52,740,224 (GRCm39) noncoding transcript Het
Gm8674 C A 13: 50,055,984 (GRCm39) noncoding transcript Het
Gpat4 G T 8: 23,670,218 (GRCm39) H270Q possibly damaging Het
Grik5 A G 7: 24,710,065 (GRCm39) L890P probably damaging Het
Gsap A G 5: 21,474,934 (GRCm39) N500S probably damaging Het
H2-M10.1 T C 17: 36,636,048 (GRCm39) D173G probably benign Het
Igfn1 T A 1: 135,901,240 (GRCm39) I413F possibly damaging Het
Ighv1-52 G T 12: 115,109,406 (GRCm39) H17N probably benign Het
Kcnu1 T A 8: 26,424,516 (GRCm39) D270E possibly damaging Het
Kif16b A C 2: 142,690,259 (GRCm39) N274K probably damaging Het
Klk1b11 C T 7: 43,648,446 (GRCm39) T151I probably benign Het
Krtap13 A G 16: 88,548,458 (GRCm39) F10S probably damaging Het
Large1 A T 8: 73,585,969 (GRCm39) I379N probably damaging Het
Lhx8 T C 3: 154,017,332 (GRCm39) H301R probably damaging Het
Lrriq3 T C 3: 154,835,021 (GRCm39) V252A probably benign Het
Lysmd3 T A 13: 81,817,311 (GRCm39) I96N probably damaging Het
Mpeg1 C T 19: 12,438,793 (GRCm39) Q84* probably null Het
Myoz1 C T 14: 20,700,722 (GRCm39) G165D probably benign Het
Myt1 G A 2: 181,439,413 (GRCm39) V312I probably benign Het
Ndufb7 T C 8: 84,293,606 (GRCm39) probably benign Het
Numa1 C T 7: 101,626,644 (GRCm39) T10M probably damaging Het
Or10d1b T A 9: 39,613,366 (GRCm39) H233L probably benign Het
Or1e30 A C 11: 73,677,790 (GRCm39) I9L probably benign Het
Or2g7 A T 17: 38,378,157 (GRCm39) I32F probably damaging Het
Or4f14d A T 2: 111,960,903 (GRCm39) D84E probably damaging Het
Or4k39 T C 2: 111,239,585 (GRCm39) noncoding transcript Het
Osmr A T 15: 6,856,756 (GRCm39) S464T probably benign Het
Pak5 G A 2: 135,925,149 (GRCm39) H718Y probably damaging Het
Pan2 T A 10: 128,150,864 (GRCm39) probably null Het
Pik3r4 T C 9: 105,546,208 (GRCm39) S853P probably benign Het
Pnkp C T 7: 44,511,827 (GRCm39) S113L probably damaging Het
Polr3gl T A 3: 96,485,795 (GRCm39) probably benign Het
Psd2 G A 18: 36,112,863 (GRCm39) R186Q possibly damaging Het
Psd4 T C 2: 24,295,450 (GRCm39) V868A probably benign Het
Ralgapa2 G T 2: 146,254,004 (GRCm39) T852K probably benign Het
Rbm43 T C 2: 51,822,435 (GRCm39) probably benign Het
Rps6kl1 C A 12: 85,186,122 (GRCm39) G329C probably damaging Het
Scaf11 T C 15: 96,317,423 (GRCm39) T714A probably benign Het
Selenoo C A 15: 88,978,508 (GRCm39) N310K possibly damaging Het
Sepsecs T C 5: 52,818,003 (GRCm39) Q258R probably damaging Het
Sgcz T C 8: 37,993,420 (GRCm39) S226G probably benign Het
Slfn5 A G 11: 82,851,754 (GRCm39) K627E probably damaging Het
Sos1 A T 17: 80,715,677 (GRCm39) F1027I probably damaging Het
Ssh1 C G 5: 114,095,459 (GRCm39) V228L possibly damaging Het
Sugp1 C A 8: 70,501,317 (GRCm39) P65T probably benign Het
Tas2r106 T A 6: 131,655,779 (GRCm39) N24I probably damaging Het
Tex10 T C 4: 48,459,272 (GRCm39) E534G possibly damaging Het
Tmem182 C T 1: 40,894,061 (GRCm39) T192I possibly damaging Het
Traf7 T A 17: 24,737,718 (GRCm39) K51* probably null Het
Trap1 C A 16: 3,861,952 (GRCm39) R604L probably damaging Het
Trim6 T A 7: 103,877,447 (GRCm39) L179Q probably damaging Het
Ubfd1 T C 7: 121,670,973 (GRCm39) S264P probably damaging Het
Upk3bl T C 5: 136,093,045 (GRCm39) probably benign Het
Wdfy3 T A 5: 102,015,972 (GRCm39) Q2601L possibly damaging Het
Wdr89 A G 12: 75,679,412 (GRCm39) Y281H probably damaging Het
Zfp286 A T 11: 62,671,551 (GRCm39) M174K probably benign Het
Zmym1 T C 4: 126,945,230 (GRCm39) probably null Het
Other mutations in Col9a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Col9a2 APN 4 120,902,389 (GRCm39) missense possibly damaging 0.95
IGL01978:Col9a2 APN 4 120,901,863 (GRCm39) missense unknown
IGL01995:Col9a2 APN 4 120,907,607 (GRCm39) critical splice donor site probably null
IGL02162:Col9a2 APN 4 120,911,531 (GRCm39) unclassified probably benign
IGL02931:Col9a2 APN 4 120,910,389 (GRCm39) missense probably benign 0.06
collision UTSW 4 120,906,913 (GRCm39) critical splice donor site probably null
gravity_wave UTSW 4 120,901,216 (GRCm39) critical splice donor site probably null
R0208:Col9a2 UTSW 4 120,909,485 (GRCm39) splice site probably benign
R0426:Col9a2 UTSW 4 120,901,857 (GRCm39) splice site probably benign
R0512:Col9a2 UTSW 4 120,911,504 (GRCm39) missense probably benign 0.22
R0973:Col9a2 UTSW 4 120,896,985 (GRCm39) critical splice donor site probably null
R1023:Col9a2 UTSW 4 120,901,207 (GRCm39) missense unknown
R1657:Col9a2 UTSW 4 120,898,171 (GRCm39) missense unknown
R1724:Col9a2 UTSW 4 120,911,099 (GRCm39) missense probably damaging 1.00
R2171:Col9a2 UTSW 4 120,902,198 (GRCm39) nonsense probably null
R2206:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2221:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2223:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2273:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2274:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2275:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2354:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2392:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2393:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2394:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3421:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3426:Col9a2 UTSW 4 120,907,604 (GRCm39) missense possibly damaging 0.93
R3710:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3821:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3838:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3839:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R4067:Col9a2 UTSW 4 120,909,586 (GRCm39) missense probably damaging 1.00
R4298:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R4299:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R4595:Col9a2 UTSW 4 120,902,352 (GRCm39) missense probably benign 0.04
R4942:Col9a2 UTSW 4 120,910,316 (GRCm39) missense possibly damaging 0.73
R5434:Col9a2 UTSW 4 120,898,162 (GRCm39) nonsense probably null
R6143:Col9a2 UTSW 4 120,911,060 (GRCm39) missense probably damaging 0.99
R7027:Col9a2 UTSW 4 120,901,216 (GRCm39) critical splice donor site probably null
R7056:Col9a2 UTSW 4 120,906,913 (GRCm39) critical splice donor site probably null
R7417:Col9a2 UTSW 4 120,911,489 (GRCm39) missense not run
R7571:Col9a2 UTSW 4 120,896,981 (GRCm39) missense unknown
R9120:Col9a2 UTSW 4 120,900,951 (GRCm39) splice site probably benign
R9341:Col9a2 UTSW 4 120,911,483 (GRCm39) missense probably benign 0.03
R9343:Col9a2 UTSW 4 120,911,483 (GRCm39) missense probably benign 0.03
R9389:Col9a2 UTSW 4 120,911,948 (GRCm39) missense probably benign 0.00
R9527:Col9a2 UTSW 4 120,899,528 (GRCm39) critical splice donor site probably null
R9620:Col9a2 UTSW 4 120,910,403 (GRCm39) critical splice donor site probably null
R9784:Col9a2 UTSW 4 120,898,226 (GRCm39) missense unknown
Z1176:Col9a2 UTSW 4 120,910,994 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCAGAATGCAGACCCAGG -3'
(R):5'- GGTTCCCGGACTAGTCAATC -3'

Sequencing Primer
(F):5'- ACAGTGCTCTCAGGTGACAG -3'
(R):5'- GGACTAGTCAATCTCCCTTCACCG -3'
Posted On 2016-06-15