Incidental Mutation 'R5120:Zmym1'
ID392913
Institutional Source Beutler Lab
Gene Symbol Zmym1
Ensembl Gene ENSMUSG00000043872
Gene Namezinc finger, MYM domain containing 1
Synonyms
MMRRC Submission 042708-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R5120 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location127047094-127061152 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 127051437 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055013] [ENSMUST00000055013] [ENSMUST00000055013] [ENSMUST00000055013] [ENSMUST00000055013] [ENSMUST00000106099] [ENSMUST00000106099] [ENSMUST00000106099] [ENSMUST00000106099] [ENSMUST00000106099] [ENSMUST00000106102] [ENSMUST00000106102] [ENSMUST00000106102] [ENSMUST00000106102] [ENSMUST00000136186]
Predicted Effect probably null
Transcript: ENSMUST00000055013
SMART Domains Protein: ENSMUSP00000050669
Gene: ENSMUSG00000043872

DomainStartEndE-ValueType
Pfam:zf-FCS 6 46 2.4e-8 PFAM
Pfam:zf-FCS 53 96 1.6e-10 PFAM
low complexity region 155 168 N/A INTRINSIC
low complexity region 229 243 N/A INTRINSIC
Pfam:DUF4371 335 569 4.9e-55 PFAM
Pfam:Dimer_Tnp_hAT 870 959 5.1e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000055013
SMART Domains Protein: ENSMUSP00000050669
Gene: ENSMUSG00000043872

DomainStartEndE-ValueType
Pfam:zf-FCS 6 46 2.4e-8 PFAM
Pfam:zf-FCS 53 96 1.6e-10 PFAM
low complexity region 155 168 N/A INTRINSIC
low complexity region 229 243 N/A INTRINSIC
Pfam:DUF4371 335 569 4.9e-55 PFAM
Pfam:Dimer_Tnp_hAT 870 959 5.1e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000055013
SMART Domains Protein: ENSMUSP00000050669
Gene: ENSMUSG00000043872

DomainStartEndE-ValueType
Pfam:zf-FCS 6 46 2.4e-8 PFAM
Pfam:zf-FCS 53 96 1.6e-10 PFAM
low complexity region 155 168 N/A INTRINSIC
low complexity region 229 243 N/A INTRINSIC
Pfam:DUF4371 335 569 4.9e-55 PFAM
Pfam:Dimer_Tnp_hAT 870 959 5.1e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000055013
SMART Domains Protein: ENSMUSP00000050669
Gene: ENSMUSG00000043872

DomainStartEndE-ValueType
Pfam:zf-FCS 6 46 2.4e-8 PFAM
Pfam:zf-FCS 53 96 1.6e-10 PFAM
low complexity region 155 168 N/A INTRINSIC
low complexity region 229 243 N/A INTRINSIC
Pfam:DUF4371 335 569 4.9e-55 PFAM
Pfam:Dimer_Tnp_hAT 870 959 5.1e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000055013
SMART Domains Protein: ENSMUSP00000050669
Gene: ENSMUSG00000043872

DomainStartEndE-ValueType
Pfam:zf-FCS 6 46 2.4e-8 PFAM
Pfam:zf-FCS 53 96 1.6e-10 PFAM
low complexity region 155 168 N/A INTRINSIC
low complexity region 229 243 N/A INTRINSIC
Pfam:DUF4371 335 569 4.9e-55 PFAM
Pfam:Dimer_Tnp_hAT 870 959 5.1e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106099
SMART Domains Protein: ENSMUSP00000101705
Gene: ENSMUSG00000043872

DomainStartEndE-ValueType
Pfam:zf-FCS 6 46 3.3e-9 PFAM
Pfam:zf-FCS 53 96 4.6e-10 PFAM
low complexity region 155 168 N/A INTRINSIC
Pfam:DUF4371 237 471 2.8e-52 PFAM
Pfam:Dimer_Tnp_hAT 772 861 5.3e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106099
SMART Domains Protein: ENSMUSP00000101705
Gene: ENSMUSG00000043872

DomainStartEndE-ValueType
Pfam:zf-FCS 6 46 3.3e-9 PFAM
Pfam:zf-FCS 53 96 4.6e-10 PFAM
low complexity region 155 168 N/A INTRINSIC
Pfam:DUF4371 237 471 2.8e-52 PFAM
Pfam:Dimer_Tnp_hAT 772 861 5.3e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106099
SMART Domains Protein: ENSMUSP00000101705
Gene: ENSMUSG00000043872

DomainStartEndE-ValueType
Pfam:zf-FCS 6 46 3.3e-9 PFAM
Pfam:zf-FCS 53 96 4.6e-10 PFAM
low complexity region 155 168 N/A INTRINSIC
Pfam:DUF4371 237 471 2.8e-52 PFAM
Pfam:Dimer_Tnp_hAT 772 861 5.3e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106099
SMART Domains Protein: ENSMUSP00000101705
Gene: ENSMUSG00000043872

DomainStartEndE-ValueType
Pfam:zf-FCS 6 46 3.3e-9 PFAM
Pfam:zf-FCS 53 96 4.6e-10 PFAM
low complexity region 155 168 N/A INTRINSIC
Pfam:DUF4371 237 471 2.8e-52 PFAM
Pfam:Dimer_Tnp_hAT 772 861 5.3e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106099
SMART Domains Protein: ENSMUSP00000101705
Gene: ENSMUSG00000043872

DomainStartEndE-ValueType
Pfam:zf-FCS 6 46 3.3e-9 PFAM
Pfam:zf-FCS 53 96 4.6e-10 PFAM
low complexity region 155 168 N/A INTRINSIC
Pfam:DUF4371 237 471 2.8e-52 PFAM
Pfam:Dimer_Tnp_hAT 772 861 5.3e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106102
SMART Domains Protein: ENSMUSP00000101708
Gene: ENSMUSG00000043872

DomainStartEndE-ValueType
Pfam:zf-FCS 6 46 7.8e-9 PFAM
Pfam:zf-FCS 53 96 1.1e-9 PFAM
low complexity region 155 168 N/A INTRINSIC
low complexity region 229 243 N/A INTRINSIC
Pfam:DUF4371 335 569 7.4e-52 PFAM
Pfam:Dimer_Tnp_hAT 870 959 1.7e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106102
SMART Domains Protein: ENSMUSP00000101708
Gene: ENSMUSG00000043872

DomainStartEndE-ValueType
Pfam:zf-FCS 6 46 7.8e-9 PFAM
Pfam:zf-FCS 53 96 1.1e-9 PFAM
low complexity region 155 168 N/A INTRINSIC
low complexity region 229 243 N/A INTRINSIC
Pfam:DUF4371 335 569 7.4e-52 PFAM
Pfam:Dimer_Tnp_hAT 870 959 1.7e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106102
SMART Domains Protein: ENSMUSP00000101708
Gene: ENSMUSG00000043872

DomainStartEndE-ValueType
Pfam:zf-FCS 6 46 7.8e-9 PFAM
Pfam:zf-FCS 53 96 1.1e-9 PFAM
low complexity region 155 168 N/A INTRINSIC
low complexity region 229 243 N/A INTRINSIC
Pfam:DUF4371 335 569 7.4e-52 PFAM
Pfam:Dimer_Tnp_hAT 870 959 1.7e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106102
SMART Domains Protein: ENSMUSP00000101708
Gene: ENSMUSG00000043872

DomainStartEndE-ValueType
Pfam:zf-FCS 6 46 7.8e-9 PFAM
Pfam:zf-FCS 53 96 1.1e-9 PFAM
low complexity region 155 168 N/A INTRINSIC
low complexity region 229 243 N/A INTRINSIC
Pfam:DUF4371 335 569 7.4e-52 PFAM
Pfam:Dimer_Tnp_hAT 870 959 1.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119262
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124429
Predicted Effect probably benign
Transcript: ENSMUST00000136186
SMART Domains Protein: ENSMUSP00000120772
Gene: ENSMUSG00000043872

DomainStartEndE-ValueType
Pfam:zf-FCS 6 46 1.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137236
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140605
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152607
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.6%
Validation Efficiency 100% (97/97)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,210,235 H225R probably benign Het
Abcc9 T A 6: 142,656,618 I690F probably benign Het
Acp4 A T 7: 44,256,971 D52E probably damaging Het
Adam17 T C 12: 21,343,019 probably benign Het
Adamts15 T C 9: 30,921,576 E221G probably damaging Het
Aoc2 A G 11: 101,325,714 T208A probably benign Het
Apoa4 T G 9: 46,242,737 I212S probably damaging Het
Bptf A T 11: 107,073,385 M1598K probably damaging Het
Camsap3 G A 8: 3,600,680 R209Q probably damaging Het
Ccdc171 C A 4: 83,558,526 probably benign Het
Celsr2 G C 3: 108,393,120 P2875A probably benign Het
Cenpb A G 2: 131,179,818 V20A probably benign Het
Cfap61 A T 2: 146,143,160 K975* probably null Het
Col9a2 G T 4: 121,039,772 A20S unknown Het
Crnn A T 3: 93,148,896 I330F probably benign Het
Csf3r C A 4: 126,035,827 P381Q probably benign Het
Csmd3 G A 15: 48,673,495 Q104* probably null Het
Ctnna1 G A 18: 35,182,554 probably null Het
Cwf19l2 C T 9: 3,418,761 Q183* probably null Het
Ddx60 T C 8: 61,945,906 Y220H probably benign Het
Dhh T C 15: 98,898,157 Q39R probably benign Het
Dynlrb2 T A 8: 116,515,698 I89N possibly damaging Het
Dytn T C 1: 63,623,043 E645G probably benign Het
Efcab7 A G 4: 99,897,491 T287A probably damaging Het
Eogt A G 6: 97,134,315 V195A probably benign Het
Ep400 G T 5: 110,756,358 P125Q probably damaging Het
Fasn A G 11: 120,811,391 V1815A probably benign Het
Gm4788 T C 1: 139,753,103 S226G probably benign Het
Gm5866 T C 5: 52,582,882 noncoding transcript Het
Gm8674 C A 13: 49,901,948 noncoding transcript Het
Gpat4 G T 8: 23,180,202 H270Q possibly damaging Het
Grik5 A G 7: 25,010,640 L890P probably damaging Het
Gsap A G 5: 21,269,936 N500S probably damaging Het
H2-M10.1 T C 17: 36,325,156 D173G probably benign Het
Igfn1 T A 1: 135,973,502 I413F possibly damaging Het
Ighv1-52 G T 12: 115,145,786 H17N probably benign Het
Kcnu1 T A 8: 25,934,488 D270E possibly damaging Het
Kif16b A C 2: 142,848,339 N274K probably damaging Het
Klk1b11 C T 7: 43,999,022 T151I probably benign Het
Krtap13 A G 16: 88,751,570 F10S probably damaging Het
Large1 A T 8: 72,859,341 I379N probably damaging Het
Lhx8 T C 3: 154,311,695 H301R probably damaging Het
Lrriq3 T C 3: 155,129,384 V252A probably benign Het
Lysmd3 T A 13: 81,669,192 I96N probably damaging Het
Mpeg1 C T 19: 12,461,429 Q84* probably null Het
Myoz1 C T 14: 20,650,654 G165D probably benign Het
Myt1 G A 2: 181,797,620 V312I probably benign Het
Ndufb7 T C 8: 83,566,977 probably benign Het
Numa1 C T 7: 101,977,437 T10M probably damaging Het
Olfr1285 T C 2: 111,409,240 noncoding transcript Het
Olfr130 A T 17: 38,067,266 I32F probably damaging Het
Olfr1316 A T 2: 112,130,558 D84E probably damaging Het
Olfr149 T A 9: 39,702,070 H233L probably benign Het
Olfr390 A C 11: 73,786,964 I9L probably benign Het
Osmr A T 15: 6,827,275 S464T probably benign Het
Pak7 G A 2: 136,083,229 H718Y probably damaging Het
Pan2 T A 10: 128,314,995 probably null Het
Pik3r4 T C 9: 105,669,009 S853P probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Polr3gl T A 3: 96,578,479 probably benign Het
Psd2 G A 18: 35,979,810 R186Q possibly damaging Het
Psd4 T C 2: 24,405,438 V868A probably benign Het
Ralgapa2 G T 2: 146,412,084 T852K probably benign Het
Rbm43 T C 2: 51,932,423 probably benign Het
Rps6kl1 C A 12: 85,139,348 G329C probably damaging Het
Scaf11 T C 15: 96,419,542 T714A probably benign Het
Selenoo C A 15: 89,094,305 N310K possibly damaging Het
Sepsecs T C 5: 52,660,661 Q258R probably damaging Het
Sgcz T C 8: 37,526,266 S226G probably benign Het
Slfn5 A G 11: 82,960,928 K627E probably damaging Het
Sos1 A T 17: 80,408,248 F1027I probably damaging Het
Ssh1 C G 5: 113,957,398 V228L possibly damaging Het
Sugp1 C A 8: 70,048,667 P65T probably benign Het
Tas2r106 T A 6: 131,678,816 N24I probably damaging Het
Tex10 T C 4: 48,459,272 E534G possibly damaging Het
Tmem182 C T 1: 40,854,901 T192I possibly damaging Het
Traf7 T A 17: 24,518,744 K51* probably null Het
Trap1 C A 16: 4,044,088 R604L probably damaging Het
Trim6 T A 7: 104,228,240 L179Q probably damaging Het
Ubfd1 T C 7: 122,071,750 S264P probably damaging Het
Upk3bl T C 5: 136,064,191 probably benign Het
Wdfy3 T A 5: 101,868,106 Q2601L possibly damaging Het
Wdr89 A G 12: 75,632,638 Y281H probably damaging Het
Zfp286 A T 11: 62,780,725 M174K probably benign Het
Other mutations in Zmym1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Zmym1 APN 4 127049642 missense probably damaging 1.00
IGL02326:Zmym1 APN 4 127047760 missense probably damaging 1.00
IGL02392:Zmym1 APN 4 127048463 missense probably damaging 1.00
IGL02431:Zmym1 APN 4 127047764 nonsense probably null
IGL02512:Zmym1 APN 4 127048672 missense probably damaging 1.00
IGL03303:Zmym1 APN 4 127049134 missense probably damaging 1.00
R0195:Zmym1 UTSW 4 127047911 missense possibly damaging 0.85
R0266:Zmym1 UTSW 4 127048025 missense possibly damaging 0.86
R0416:Zmym1 UTSW 4 127058820 missense probably benign 0.00
R1374:Zmym1 UTSW 4 127049611 missense probably damaging 1.00
R1480:Zmym1 UTSW 4 127048612 missense probably damaging 0.99
R1704:Zmym1 UTSW 4 127048384 missense probably damaging 1.00
R1806:Zmym1 UTSW 4 127048079 missense probably damaging 1.00
R1815:Zmym1 UTSW 4 127049021 missense possibly damaging 0.76
R2124:Zmym1 UTSW 4 127049570 missense probably benign 0.05
R2169:Zmym1 UTSW 4 127054203 splice site probably null
R4027:Zmym1 UTSW 4 127049879 missense probably benign 0.08
R4410:Zmym1 UTSW 4 127048104 nonsense probably null
R4572:Zmym1 UTSW 4 127050835 missense probably benign 0.39
R4788:Zmym1 UTSW 4 127054297 missense probably benign 0.10
R5130:Zmym1 UTSW 4 127048658 missense probably damaging 1.00
R5615:Zmym1 UTSW 4 127049398 missense probably damaging 1.00
R6190:Zmym1 UTSW 4 127047884 missense probably damaging 0.99
R7426:Zmym1 UTSW 4 127049398 missense possibly damaging 0.81
R7464:Zmym1 UTSW 4 127058935 nonsense probably null
R7540:Zmym1 UTSW 4 127048757 missense probably benign
R7779:Zmym1 UTSW 4 127054245 missense probably benign
R7807:Zmym1 UTSW 4 127047874 missense probably damaging 1.00
T0722:Zmym1 UTSW 4 127047947 missense probably benign 0.00
T0722:Zmym1 UTSW 4 127048250 missense probably benign 0.01
T0722:Zmym1 UTSW 4 127049673 missense probably benign 0.05
T0975:Zmym1 UTSW 4 127047947 missense probably benign 0.00
T0975:Zmym1 UTSW 4 127048250 missense probably benign 0.01
T0975:Zmym1 UTSW 4 127049673 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GGCATTACCTGAAGGAGACTCC -3'
(R):5'- CCCAGGATCGTATGGTAGATAC -3'

Sequencing Primer
(F):5'- CTCCATCACAGCACTGTTGTATGAAG -3'
(R):5'- TGCAAGGGCTCATGTCCAAG -3'
Posted On2016-06-15