Incidental Mutation 'R5120:Wdfy3'
ID392917
Institutional Source Beutler Lab
Gene Symbol Wdfy3
Ensembl Gene ENSMUSG00000043940
Gene NameWD repeat and FYVE domain containing 3
SynonymsD5Ertd66e, Bwf1, Bchs, 2610509D04Rik, Ggtb3
MMRRC Submission 042708-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.923) question?
Stock #R5120 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location101832956-102069921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101868106 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 2601 (Q2601L)
Ref Sequence ENSEMBL: ENSMUSP00000134244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053177] [ENSMUST00000174598] [ENSMUST00000212024]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053177
AA Change: Q2583L

PolyPhen 2 Score 0.739 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000052607
Gene: ENSMUSG00000043940
AA Change: Q2583L

DomainStartEndE-ValueType
low complexity region 463 481 N/A INTRINSIC
low complexity region 1408 1417 N/A INTRINSIC
low complexity region 1629 1644 N/A INTRINSIC
Pfam:PH_BEACH 2517 2638 3.1e-17 PFAM
Beach 2677 2958 2.54e-217 SMART
WD40 3054 3088 1.28e1 SMART
WD40 3098 3137 7.73e-6 SMART
WD40 3140 3178 8.29e-1 SMART
WD40 3183 3227 3.09e-1 SMART
low complexity region 3253 3274 N/A INTRINSIC
low complexity region 3307 3318 N/A INTRINSIC
WD40 3381 3420 1.33e1 SMART
FYVE 3428 3497 3.18e-27 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000174598
AA Change: Q2601L

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134244
Gene: ENSMUSG00000043940
AA Change: Q2601L

DomainStartEndE-ValueType
low complexity region 463 481 N/A INTRINSIC
Pfam:DUF4704 1392 1597 6.6e-11 PFAM
low complexity region 1629 1644 N/A INTRINSIC
Pfam:PH_BEACH 2588 2656 1.8e-14 PFAM
Beach 2695 2976 2.54e-217 SMART
WD40 3072 3106 1.28e1 SMART
WD40 3116 3155 7.73e-6 SMART
WD40 3158 3196 8.29e-1 SMART
WD40 3201 3245 3.09e-1 SMART
low complexity region 3271 3292 N/A INTRINSIC
low complexity region 3325 3336 N/A INTRINSIC
WD40 3399 3438 1.33e1 SMART
FYVE 3446 3515 3.18e-27 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000212024
AA Change: Q2587L

PolyPhen 2 Score 0.694 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.1432 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.6%
Validation Efficiency 100% (97/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol 3-phosphate-binding protein that functions as a master conductor for aggregate clearance by autophagy. This protein shuttles from the nuclear membrane to colocalize with aggregated proteins, where it complexes with other autophagic components to achieve macroautophagy-mediated clearance of these aggregated proteins. However, it is not necessary for starvation-induced macroautophagy. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for hypomorphic mutations of this gene exhibit perinatal lethality, altered neural progenitor divisions and neuronal migration, a regionally enlarged cerebral cortex, and focal cortical dysplasias. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,210,235 H225R probably benign Het
Abcc9 T A 6: 142,656,618 I690F probably benign Het
Acp4 A T 7: 44,256,971 D52E probably damaging Het
Adam17 T C 12: 21,343,019 probably benign Het
Adamts15 T C 9: 30,921,576 E221G probably damaging Het
Aoc2 A G 11: 101,325,714 T208A probably benign Het
Apoa4 T G 9: 46,242,737 I212S probably damaging Het
Bptf A T 11: 107,073,385 M1598K probably damaging Het
Camsap3 G A 8: 3,600,680 R209Q probably damaging Het
Ccdc171 C A 4: 83,558,526 probably benign Het
Celsr2 G C 3: 108,393,120 P2875A probably benign Het
Cenpb A G 2: 131,179,818 V20A probably benign Het
Cfap61 A T 2: 146,143,160 K975* probably null Het
Col9a2 G T 4: 121,039,772 A20S unknown Het
Crnn A T 3: 93,148,896 I330F probably benign Het
Csf3r C A 4: 126,035,827 P381Q probably benign Het
Csmd3 G A 15: 48,673,495 Q104* probably null Het
Ctnna1 G A 18: 35,182,554 probably null Het
Cwf19l2 C T 9: 3,418,761 Q183* probably null Het
Ddx60 T C 8: 61,945,906 Y220H probably benign Het
Dhh T C 15: 98,898,157 Q39R probably benign Het
Dynlrb2 T A 8: 116,515,698 I89N possibly damaging Het
Dytn T C 1: 63,623,043 E645G probably benign Het
Efcab7 A G 4: 99,897,491 T287A probably damaging Het
Eogt A G 6: 97,134,315 V195A probably benign Het
Ep400 G T 5: 110,756,358 P125Q probably damaging Het
Fasn A G 11: 120,811,391 V1815A probably benign Het
Gm4788 T C 1: 139,753,103 S226G probably benign Het
Gm5866 T C 5: 52,582,882 noncoding transcript Het
Gm8674 C A 13: 49,901,948 noncoding transcript Het
Gpat4 G T 8: 23,180,202 H270Q possibly damaging Het
Grik5 A G 7: 25,010,640 L890P probably damaging Het
Gsap A G 5: 21,269,936 N500S probably damaging Het
H2-M10.1 T C 17: 36,325,156 D173G probably benign Het
Igfn1 T A 1: 135,973,502 I413F possibly damaging Het
Ighv1-52 G T 12: 115,145,786 H17N probably benign Het
Kcnu1 T A 8: 25,934,488 D270E possibly damaging Het
Kif16b A C 2: 142,848,339 N274K probably damaging Het
Klk1b11 C T 7: 43,999,022 T151I probably benign Het
Krtap13 A G 16: 88,751,570 F10S probably damaging Het
Large1 A T 8: 72,859,341 I379N probably damaging Het
Lhx8 T C 3: 154,311,695 H301R probably damaging Het
Lrriq3 T C 3: 155,129,384 V252A probably benign Het
Lysmd3 T A 13: 81,669,192 I96N probably damaging Het
Mpeg1 C T 19: 12,461,429 Q84* probably null Het
Myoz1 C T 14: 20,650,654 G165D probably benign Het
Myt1 G A 2: 181,797,620 V312I probably benign Het
Ndufb7 T C 8: 83,566,977 probably benign Het
Numa1 C T 7: 101,977,437 T10M probably damaging Het
Olfr1285 T C 2: 111,409,240 noncoding transcript Het
Olfr130 A T 17: 38,067,266 I32F probably damaging Het
Olfr1316 A T 2: 112,130,558 D84E probably damaging Het
Olfr149 T A 9: 39,702,070 H233L probably benign Het
Olfr390 A C 11: 73,786,964 I9L probably benign Het
Osmr A T 15: 6,827,275 S464T probably benign Het
Pak7 G A 2: 136,083,229 H718Y probably damaging Het
Pan2 T A 10: 128,314,995 probably null Het
Pik3r4 T C 9: 105,669,009 S853P probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Polr3gl T A 3: 96,578,479 probably benign Het
Psd2 G A 18: 35,979,810 R186Q possibly damaging Het
Psd4 T C 2: 24,405,438 V868A probably benign Het
Ralgapa2 G T 2: 146,412,084 T852K probably benign Het
Rbm43 T C 2: 51,932,423 probably benign Het
Rps6kl1 C A 12: 85,139,348 G329C probably damaging Het
Scaf11 T C 15: 96,419,542 T714A probably benign Het
Selenoo C A 15: 89,094,305 N310K possibly damaging Het
Sepsecs T C 5: 52,660,661 Q258R probably damaging Het
Sgcz T C 8: 37,526,266 S226G probably benign Het
Slfn5 A G 11: 82,960,928 K627E probably damaging Het
Sos1 A T 17: 80,408,248 F1027I probably damaging Het
Ssh1 C G 5: 113,957,398 V228L possibly damaging Het
Sugp1 C A 8: 70,048,667 P65T probably benign Het
Tas2r106 T A 6: 131,678,816 N24I probably damaging Het
Tex10 T C 4: 48,459,272 E534G possibly damaging Het
Tmem182 C T 1: 40,854,901 T192I possibly damaging Het
Traf7 T A 17: 24,518,744 K51* probably null Het
Trap1 C A 16: 4,044,088 R604L probably damaging Het
Trim6 T A 7: 104,228,240 L179Q probably damaging Het
Ubfd1 T C 7: 122,071,750 S264P probably damaging Het
Upk3bl T C 5: 136,064,191 probably benign Het
Wdr89 A G 12: 75,632,638 Y281H probably damaging Het
Zfp286 A T 11: 62,780,725 M174K probably benign Het
Zmym1 T C 4: 127,051,437 probably null Het
Other mutations in Wdfy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Wdfy3 APN 5 101915338 critical splice donor site probably null
IGL00567:Wdfy3 APN 5 101912030 splice site probably benign
IGL01288:Wdfy3 APN 5 101901991 splice site probably null
IGL01323:Wdfy3 APN 5 101895064 missense probably damaging 1.00
IGL01352:Wdfy3 APN 5 101944120 missense probably damaging 1.00
IGL01553:Wdfy3 APN 5 101900031 missense probably benign
IGL01560:Wdfy3 APN 5 101957486 nonsense probably null
IGL01566:Wdfy3 APN 5 101896588 splice site probably benign
IGL01616:Wdfy3 APN 5 101913260 missense probably damaging 0.97
IGL01630:Wdfy3 APN 5 101907488 missense probably benign
IGL01791:Wdfy3 APN 5 101937412 missense probably damaging 1.00
IGL01820:Wdfy3 APN 5 101924081 missense probably benign 0.11
IGL01953:Wdfy3 APN 5 101895028 nonsense probably null
IGL02121:Wdfy3 APN 5 101898510 missense possibly damaging 0.85
IGL02167:Wdfy3 APN 5 101961157 missense probably damaging 0.98
IGL02321:Wdfy3 APN 5 101922609 missense probably damaging 0.99
IGL02327:Wdfy3 APN 5 101888192 missense probably damaging 1.00
IGL02651:Wdfy3 APN 5 101896475 missense probably benign 0.37
IGL02801:Wdfy3 APN 5 101907587 missense probably damaging 1.00
IGL02839:Wdfy3 APN 5 101968920 missense probably damaging 1.00
IGL02870:Wdfy3 APN 5 101855471 missense probably damaging 1.00
IGL02997:Wdfy3 APN 5 101894912 missense probably null 1.00
IGL03064:Wdfy3 APN 5 101935997 missense probably damaging 0.99
IGL03090:Wdfy3 APN 5 101866276 missense probably damaging 1.00
IGL03211:Wdfy3 APN 5 101844912 splice site probably benign
IGL03237:Wdfy3 APN 5 101844599 missense probably damaging 1.00
IGL03264:Wdfy3 APN 5 101900150 missense probably damaging 1.00
Esurient UTSW 5 101944103 missense probably damaging 1.00
IGL02988:Wdfy3 UTSW 5 101929981 missense probably damaging 0.99
PIT4382001:Wdfy3 UTSW 5 101882961 frame shift probably null
R0010:Wdfy3 UTSW 5 101848349 missense probably damaging 1.00
R0010:Wdfy3 UTSW 5 101848349 missense probably damaging 1.00
R0025:Wdfy3 UTSW 5 101845046 missense probably damaging 0.98
R0031:Wdfy3 UTSW 5 101889295 missense probably damaging 0.97
R0047:Wdfy3 UTSW 5 101944033 missense probably damaging 1.00
R0047:Wdfy3 UTSW 5 101944033 missense probably damaging 1.00
R0053:Wdfy3 UTSW 5 101844614 missense probably damaging 0.97
R0078:Wdfy3 UTSW 5 101888105 missense possibly damaging 0.57
R0147:Wdfy3 UTSW 5 101917411 missense probably benign 0.05
R0148:Wdfy3 UTSW 5 101917411 missense probably benign 0.05
R0279:Wdfy3 UTSW 5 101868092 missense probably damaging 1.00
R0380:Wdfy3 UTSW 5 101948966 missense probably damaging 0.99
R0472:Wdfy3 UTSW 5 101957443 missense probably benign 0.13
R0513:Wdfy3 UTSW 5 101890789 missense probably damaging 0.96
R0594:Wdfy3 UTSW 5 101906185 missense possibly damaging 0.94
R0601:Wdfy3 UTSW 5 101836172 missense probably benign
R0787:Wdfy3 UTSW 5 101957388 missense probably damaging 1.00
R0825:Wdfy3 UTSW 5 101870051 missense probably damaging 1.00
R1122:Wdfy3 UTSW 5 101882966 missense possibly damaging 0.94
R1167:Wdfy3 UTSW 5 101875931 missense probably benign
R1350:Wdfy3 UTSW 5 101898552 missense probably damaging 1.00
R1422:Wdfy3 UTSW 5 101884214 splice site probably benign
R1446:Wdfy3 UTSW 5 101851310 missense possibly damaging 0.68
R1452:Wdfy3 UTSW 5 101937738 missense possibly damaging 0.91
R1457:Wdfy3 UTSW 5 101917579 missense possibly damaging 0.57
R1543:Wdfy3 UTSW 5 101844081 missense probably benign
R1633:Wdfy3 UTSW 5 101981548 missense probably damaging 1.00
R1643:Wdfy3 UTSW 5 101875915 missense possibly damaging 0.62
R1656:Wdfy3 UTSW 5 101941447 missense probably damaging 1.00
R1720:Wdfy3 UTSW 5 101926525 frame shift probably null
R1743:Wdfy3 UTSW 5 101844065 missense probably benign 0.12
R1745:Wdfy3 UTSW 5 101948929 missense probably damaging 0.96
R1850:Wdfy3 UTSW 5 101894999 missense probably damaging 1.00
R1852:Wdfy3 UTSW 5 101915376 missense probably benign 0.00
R1854:Wdfy3 UTSW 5 101888186 missense probably benign 0.05
R1880:Wdfy3 UTSW 5 101917435 missense probably benign 0.05
R1930:Wdfy3 UTSW 5 101941492 missense probably damaging 1.00
R1931:Wdfy3 UTSW 5 101941492 missense probably damaging 1.00
R1956:Wdfy3 UTSW 5 101919409 missense probably benign 0.30
R1965:Wdfy3 UTSW 5 101951312 missense probably damaging 1.00
R1997:Wdfy3 UTSW 5 101968946 missense probably damaging 1.00
R2015:Wdfy3 UTSW 5 101860486 missense probably null 1.00
R2087:Wdfy3 UTSW 5 101895060 missense probably damaging 1.00
R2156:Wdfy3 UTSW 5 101898425 critical splice donor site probably null
R2192:Wdfy3 UTSW 5 101907542 missense possibly damaging 0.55
R2313:Wdfy3 UTSW 5 101889284 missense probably damaging 1.00
R2332:Wdfy3 UTSW 5 101888323 splice site probably benign
R2406:Wdfy3 UTSW 5 101888259 missense probably damaging 1.00
R2679:Wdfy3 UTSW 5 101870036 missense probably damaging 1.00
R2857:Wdfy3 UTSW 5 101875930 missense probably benign 0.04
R2937:Wdfy3 UTSW 5 101944122 missense probably benign 0.07
R3765:Wdfy3 UTSW 5 101861400 missense probably damaging 1.00
R3795:Wdfy3 UTSW 5 101937600 missense probably damaging 1.00
R3937:Wdfy3 UTSW 5 101944239 nonsense probably null
R3947:Wdfy3 UTSW 5 101870036 missense probably damaging 1.00
R4024:Wdfy3 UTSW 5 101924095 splice site probably benign
R4065:Wdfy3 UTSW 5 101922447 missense probably benign 0.08
R4066:Wdfy3 UTSW 5 101922447 missense probably benign 0.08
R4110:Wdfy3 UTSW 5 101900058 critical splice donor site probably null
R4235:Wdfy3 UTSW 5 101922634 critical splice acceptor site probably null
R4420:Wdfy3 UTSW 5 101910984 missense probably damaging 0.97
R4620:Wdfy3 UTSW 5 101906145 missense probably damaging 0.99
R4624:Wdfy3 UTSW 5 101884083 missense possibly damaging 0.52
R4626:Wdfy3 UTSW 5 101943934 missense probably damaging 1.00
R4727:Wdfy3 UTSW 5 101930028 missense probably damaging 0.99
R4794:Wdfy3 UTSW 5 101943943 missense probably damaging 1.00
R4869:Wdfy3 UTSW 5 101894921 missense probably damaging 0.98
R4971:Wdfy3 UTSW 5 101948972 nonsense probably null
R4973:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R4976:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R4984:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R4986:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R5068:Wdfy3 UTSW 5 101894937 missense probably benign 0.15
R5105:Wdfy3 UTSW 5 101855549 missense probably damaging 1.00
R5134:Wdfy3 UTSW 5 101944103 missense probably damaging 1.00
R5139:Wdfy3 UTSW 5 101849267 critical splice donor site probably null
R5235:Wdfy3 UTSW 5 101847106 missense probably null 0.03
R5303:Wdfy3 UTSW 5 101952983 missense probably damaging 1.00
R5368:Wdfy3 UTSW 5 101872858 missense probably damaging 1.00
R5426:Wdfy3 UTSW 5 101919446 missense probably damaging 0.97
R5442:Wdfy3 UTSW 5 101896559 missense probably benign 0.04
R5487:Wdfy3 UTSW 5 101836274 missense probably damaging 1.00
R5509:Wdfy3 UTSW 5 101861448 missense possibly damaging 0.69
R5877:Wdfy3 UTSW 5 101869989 missense probably damaging 1.00
R5988:Wdfy3 UTSW 5 101884138 missense probably benign 0.00
R6017:Wdfy3 UTSW 5 101851359 missense probably benign 0.01
R6019:Wdfy3 UTSW 5 101849423 missense probably damaging 1.00
R6199:Wdfy3 UTSW 5 101872965 missense possibly damaging 0.93
R6228:Wdfy3 UTSW 5 101898429 missense possibly damaging 0.67
R6258:Wdfy3 UTSW 5 101872965 missense possibly damaging 0.93
R6259:Wdfy3 UTSW 5 101872965 missense possibly damaging 0.93
R6298:Wdfy3 UTSW 5 101968946 missense probably damaging 1.00
R6479:Wdfy3 UTSW 5 101913179 missense probably damaging 1.00
R6550:Wdfy3 UTSW 5 101953166 missense probably benign 0.19
R6776:Wdfy3 UTSW 5 101884045 missense possibly damaging 0.57
R6793:Wdfy3 UTSW 5 101917431 nonsense probably null
R6809:Wdfy3 UTSW 5 101923947 missense possibly damaging 0.63
R6836:Wdfy3 UTSW 5 101952999 missense probably damaging 1.00
R6897:Wdfy3 UTSW 5 101844066 missense probably benign 0.10
R7014:Wdfy3 UTSW 5 101894909 critical splice donor site probably null
R7034:Wdfy3 UTSW 5 101907518 missense probably damaging 1.00
R7035:Wdfy3 UTSW 5 101855549 missense probably damaging 1.00
R7135:Wdfy3 UTSW 5 101915437 missense probably damaging 1.00
R7182:Wdfy3 UTSW 5 101943892 missense possibly damaging 0.51
R7217:Wdfy3 UTSW 5 101901919 missense probably damaging 1.00
R7236:Wdfy3 UTSW 5 101836208 missense probably damaging 0.99
R7264:Wdfy3 UTSW 5 101855523 missense probably benign 0.02
R7418:Wdfy3 UTSW 5 101957500 missense probably benign 0.08
R7533:Wdfy3 UTSW 5 101882488 missense probably benign 0.27
R7543:Wdfy3 UTSW 5 101936059 missense probably benign 0.00
R7625:Wdfy3 UTSW 5 101855386 splice site probably null
R7788:Wdfy3 UTSW 5 101848357 missense probably damaging 0.99
R7810:Wdfy3 UTSW 5 101895074 missense probably benign 0.01
R7810:Wdfy3 UTSW 5 101951399 nonsense probably null
R8204:Wdfy3 UTSW 5 101852585 missense probably benign 0.00
R8268:Wdfy3 UTSW 5 101941610 missense probably damaging 1.00
R8286:Wdfy3 UTSW 5 101937421 missense probably benign
Z1177:Wdfy3 UTSW 5 101900241 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- ATTGGAGGCAGCAATGCGTG -3'
(R):5'- GAGAAAACGCTTTGATGGTGATC -3'

Sequencing Primer
(F):5'- GCTGCAGTTCTCACAACACTGG -3'
(R):5'- GTGATCTTCAGAAGGGTTCCCAAC -3'
Posted On2016-06-15