Incidental Mutation 'R5120:Ep400'
ID 392918
Institutional Source Beutler Lab
Gene Symbol Ep400
Ensembl Gene ENSMUSG00000029505
Gene Name E1A binding protein p400
Synonyms 1700020J09Rik, p400, mDomino
MMRRC Submission 042708-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5120 (G1)
Quality Score 201
Status Validated
Chromosome 5
Chromosomal Location 110812239-110918583 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 110904224 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Glutamine at position 125 (P125Q)
Ref Sequence ENSEMBL: ENSMUSP00000138369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041558] [ENSMUST00000112433] [ENSMUST00000112435] [ENSMUST00000112436] [ENSMUST00000146458]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000041558
AA Change: P125Q
SMART Domains Protein: ENSMUSP00000049038
Gene: ENSMUSG00000029505
AA Change: P125Q

DomainStartEndE-ValueType
Pfam:EP400_N 1 461 1.6e-232 PFAM
low complexity region 519 532 N/A INTRINSIC
low complexity region 550 561 N/A INTRINSIC
low complexity region 598 620 N/A INTRINSIC
low complexity region 631 645 N/A INTRINSIC
low complexity region 658 686 N/A INTRINSIC
HSA 762 833 1.31e-31 SMART
low complexity region 908 925 N/A INTRINSIC
DEXDc 1049 1238 2.76e-15 SMART
Blast:DEXDc 1276 1317 2e-15 BLAST
low complexity region 1407 1417 N/A INTRINSIC
HELICc 1807 1893 1.17e-4 SMART
low complexity region 2006 2019 N/A INTRINSIC
low complexity region 2080 2100 N/A INTRINSIC
low complexity region 2214 2223 N/A INTRINSIC
SANT 2243 2310 3.57e-1 SMART
low complexity region 2402 2489 N/A INTRINSIC
low complexity region 2596 2608 N/A INTRINSIC
low complexity region 2644 2679 N/A INTRINSIC
low complexity region 2694 2738 N/A INTRINSIC
low complexity region 2769 2806 N/A INTRINSIC
low complexity region 2846 2883 N/A INTRINSIC
low complexity region 2933 2947 N/A INTRINSIC
low complexity region 2974 2986 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112433
AA Change: P125Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108052
Gene: ENSMUSG00000029505
AA Change: P125Q

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 447 N/A INTRINSIC
low complexity region 471 485 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 635 657 N/A INTRINSIC
low complexity region 666 677 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000112435
AA Change: P125Q
SMART Domains Protein: ENSMUSP00000108054
Gene: ENSMUSG00000029505
AA Change: P125Q

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 447 N/A INTRINSIC
low complexity region 471 485 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 635 657 N/A INTRINSIC
low complexity region 668 682 N/A INTRINSIC
low complexity region 695 723 N/A INTRINSIC
HSA 799 870 1.31e-31 SMART
low complexity region 945 962 N/A INTRINSIC
DEXDc 1086 1275 2.76e-15 SMART
Blast:DEXDc 1313 1354 2e-15 BLAST
low complexity region 1444 1454 N/A INTRINSIC
internal_repeat_1 1556 1646 6.82e-5 PROSPERO
low complexity region 1887 1900 N/A INTRINSIC
low complexity region 1961 1981 N/A INTRINSIC
low complexity region 2095 2104 N/A INTRINSIC
SANT 2124 2191 3.57e-1 SMART
low complexity region 2283 2370 N/A INTRINSIC
internal_repeat_1 2371 2463 6.82e-5 PROSPERO
low complexity region 2477 2489 N/A INTRINSIC
low complexity region 2525 2560 N/A INTRINSIC
low complexity region 2575 2619 N/A INTRINSIC
low complexity region 2645 2659 N/A INTRINSIC
low complexity region 2660 2680 N/A INTRINSIC
low complexity region 2720 2757 N/A INTRINSIC
low complexity region 2807 2821 N/A INTRINSIC
low complexity region 2848 2860 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000112436
AA Change: P125Q
SMART Domains Protein: ENSMUSP00000108055
Gene: ENSMUSG00000029505
AA Change: P125Q

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 449 N/A INTRINSIC
low complexity region 472 482 N/A INTRINSIC
low complexity region 483 496 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
low complexity region 595 609 N/A INTRINSIC
low complexity region 622 650 N/A INTRINSIC
HSA 726 797 1.31e-31 SMART
low complexity region 872 889 N/A INTRINSIC
DEXDc 1013 1202 2.76e-15 SMART
Blast:DEXDc 1240 1281 2e-15 BLAST
low complexity region 1371 1381 N/A INTRINSIC
internal_repeat_1 1483 1573 6.76e-5 PROSPERO
HELICc 1771 1857 1.17e-4 SMART
low complexity region 1970 1983 N/A INTRINSIC
low complexity region 2044 2064 N/A INTRINSIC
low complexity region 2178 2187 N/A INTRINSIC
SANT 2207 2274 3.57e-1 SMART
low complexity region 2366 2453 N/A INTRINSIC
internal_repeat_1 2454 2546 6.76e-5 PROSPERO
low complexity region 2560 2572 N/A INTRINSIC
low complexity region 2608 2643 N/A INTRINSIC
low complexity region 2658 2702 N/A INTRINSIC
low complexity region 2733 2770 N/A INTRINSIC
low complexity region 2810 2847 N/A INTRINSIC
low complexity region 2897 2911 N/A INTRINSIC
low complexity region 2938 2950 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000146458
AA Change: P125Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138369
Gene: ENSMUSG00000029505
AA Change: P125Q

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 449 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
low complexity region 550 561 N/A INTRINSIC
low complexity region 598 620 N/A INTRINSIC
low complexity region 629 640 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146652
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178031
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.6%
Validation Efficiency 100% (97/97)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die at E11.5 and display severe defects in yolk sac erythropoiesis, anemia, and a slight deformity of the neural tube. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,101,061 (GRCm39) H225R probably benign Het
Abcc9 T A 6: 142,602,344 (GRCm39) I690F probably benign Het
Acp4 A T 7: 43,906,395 (GRCm39) D52E probably damaging Het
Adam17 T C 12: 21,393,020 (GRCm39) probably benign Het
Adamts15 T C 9: 30,832,872 (GRCm39) E221G probably damaging Het
Aoc2 A G 11: 101,216,540 (GRCm39) T208A probably benign Het
Apoa4 T G 9: 46,154,035 (GRCm39) I212S probably damaging Het
Bptf A T 11: 106,964,211 (GRCm39) M1598K probably damaging Het
Camsap3 G A 8: 3,650,680 (GRCm39) R209Q probably damaging Het
Ccdc171 C A 4: 83,476,763 (GRCm39) probably benign Het
Celsr2 G C 3: 108,300,436 (GRCm39) P2875A probably benign Het
Cenpb A G 2: 131,021,738 (GRCm39) V20A probably benign Het
Cfap61 A T 2: 145,985,080 (GRCm39) K975* probably null Het
Cfhr4 T C 1: 139,680,841 (GRCm39) S226G probably benign Het
Col9a2 G T 4: 120,896,969 (GRCm39) A20S unknown Het
Crnn A T 3: 93,056,203 (GRCm39) I330F probably benign Het
Csf3r C A 4: 125,929,620 (GRCm39) P381Q probably benign Het
Csmd3 G A 15: 48,536,891 (GRCm39) Q104* probably null Het
Ctnna1 G A 18: 35,315,607 (GRCm39) probably null Het
Cwf19l2 C T 9: 3,418,761 (GRCm39) Q183* probably null Het
Ddx60 T C 8: 62,398,940 (GRCm39) Y220H probably benign Het
Dhh T C 15: 98,796,038 (GRCm39) Q39R probably benign Het
Dynlrb2 T A 8: 117,242,437 (GRCm39) I89N possibly damaging Het
Dytn T C 1: 63,662,202 (GRCm39) E645G probably benign Het
Efcab7 A G 4: 99,754,688 (GRCm39) T287A probably damaging Het
Eogt A G 6: 97,111,276 (GRCm39) V195A probably benign Het
Fasn A G 11: 120,702,217 (GRCm39) V1815A probably benign Het
Gm5866 T C 5: 52,740,224 (GRCm39) noncoding transcript Het
Gm8674 C A 13: 50,055,984 (GRCm39) noncoding transcript Het
Gpat4 G T 8: 23,670,218 (GRCm39) H270Q possibly damaging Het
Grik5 A G 7: 24,710,065 (GRCm39) L890P probably damaging Het
Gsap A G 5: 21,474,934 (GRCm39) N500S probably damaging Het
H2-M10.1 T C 17: 36,636,048 (GRCm39) D173G probably benign Het
Igfn1 T A 1: 135,901,240 (GRCm39) I413F possibly damaging Het
Ighv1-52 G T 12: 115,109,406 (GRCm39) H17N probably benign Het
Kcnu1 T A 8: 26,424,516 (GRCm39) D270E possibly damaging Het
Kif16b A C 2: 142,690,259 (GRCm39) N274K probably damaging Het
Klk1b11 C T 7: 43,648,446 (GRCm39) T151I probably benign Het
Krtap13 A G 16: 88,548,458 (GRCm39) F10S probably damaging Het
Large1 A T 8: 73,585,969 (GRCm39) I379N probably damaging Het
Lhx8 T C 3: 154,017,332 (GRCm39) H301R probably damaging Het
Lrriq3 T C 3: 154,835,021 (GRCm39) V252A probably benign Het
Lysmd3 T A 13: 81,817,311 (GRCm39) I96N probably damaging Het
Mpeg1 C T 19: 12,438,793 (GRCm39) Q84* probably null Het
Myoz1 C T 14: 20,700,722 (GRCm39) G165D probably benign Het
Myt1 G A 2: 181,439,413 (GRCm39) V312I probably benign Het
Ndufb7 T C 8: 84,293,606 (GRCm39) probably benign Het
Numa1 C T 7: 101,626,644 (GRCm39) T10M probably damaging Het
Or10d1b T A 9: 39,613,366 (GRCm39) H233L probably benign Het
Or1e30 A C 11: 73,677,790 (GRCm39) I9L probably benign Het
Or2g7 A T 17: 38,378,157 (GRCm39) I32F probably damaging Het
Or4f14d A T 2: 111,960,903 (GRCm39) D84E probably damaging Het
Or4k39 T C 2: 111,239,585 (GRCm39) noncoding transcript Het
Osmr A T 15: 6,856,756 (GRCm39) S464T probably benign Het
Pak5 G A 2: 135,925,149 (GRCm39) H718Y probably damaging Het
Pan2 T A 10: 128,150,864 (GRCm39) probably null Het
Pik3r4 T C 9: 105,546,208 (GRCm39) S853P probably benign Het
Pnkp C T 7: 44,511,827 (GRCm39) S113L probably damaging Het
Polr3gl T A 3: 96,485,795 (GRCm39) probably benign Het
Psd2 G A 18: 36,112,863 (GRCm39) R186Q possibly damaging Het
Psd4 T C 2: 24,295,450 (GRCm39) V868A probably benign Het
Ralgapa2 G T 2: 146,254,004 (GRCm39) T852K probably benign Het
Rbm43 T C 2: 51,822,435 (GRCm39) probably benign Het
Rps6kl1 C A 12: 85,186,122 (GRCm39) G329C probably damaging Het
Scaf11 T C 15: 96,317,423 (GRCm39) T714A probably benign Het
Selenoo C A 15: 88,978,508 (GRCm39) N310K possibly damaging Het
Sepsecs T C 5: 52,818,003 (GRCm39) Q258R probably damaging Het
Sgcz T C 8: 37,993,420 (GRCm39) S226G probably benign Het
Slfn5 A G 11: 82,851,754 (GRCm39) K627E probably damaging Het
Sos1 A T 17: 80,715,677 (GRCm39) F1027I probably damaging Het
Ssh1 C G 5: 114,095,459 (GRCm39) V228L possibly damaging Het
Sugp1 C A 8: 70,501,317 (GRCm39) P65T probably benign Het
Tas2r106 T A 6: 131,655,779 (GRCm39) N24I probably damaging Het
Tex10 T C 4: 48,459,272 (GRCm39) E534G possibly damaging Het
Tmem182 C T 1: 40,894,061 (GRCm39) T192I possibly damaging Het
Traf7 T A 17: 24,737,718 (GRCm39) K51* probably null Het
Trap1 C A 16: 3,861,952 (GRCm39) R604L probably damaging Het
Trim6 T A 7: 103,877,447 (GRCm39) L179Q probably damaging Het
Ubfd1 T C 7: 121,670,973 (GRCm39) S264P probably damaging Het
Upk3bl T C 5: 136,093,045 (GRCm39) probably benign Het
Wdfy3 T A 5: 102,015,972 (GRCm39) Q2601L possibly damaging Het
Wdr89 A G 12: 75,679,412 (GRCm39) Y281H probably damaging Het
Zfp286 A T 11: 62,671,551 (GRCm39) M174K probably benign Het
Zmym1 T C 4: 126,945,230 (GRCm39) probably null Het
Other mutations in Ep400
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ep400 APN 5 110,835,707 (GRCm39) missense unknown
IGL00585:Ep400 APN 5 110,903,771 (GRCm39) missense possibly damaging 0.70
IGL00586:Ep400 APN 5 110,887,460 (GRCm39) missense probably damaging 1.00
IGL00816:Ep400 APN 5 110,883,356 (GRCm39) unclassified probably benign
IGL01066:Ep400 APN 5 110,816,065 (GRCm39) splice site probably benign
IGL01302:Ep400 APN 5 110,889,914 (GRCm39) missense probably benign 0.00
IGL01568:Ep400 APN 5 110,867,361 (GRCm39) missense unknown
IGL01833:Ep400 APN 5 110,827,874 (GRCm39) missense unknown
IGL02086:Ep400 APN 5 110,824,809 (GRCm39) splice site probably benign
IGL02266:Ep400 APN 5 110,843,163 (GRCm39) unclassified probably benign
IGL02288:Ep400 APN 5 110,831,702 (GRCm39) splice site probably benign
IGL02301:Ep400 APN 5 110,822,826 (GRCm39) missense probably damaging 1.00
IGL02377:Ep400 APN 5 110,868,691 (GRCm39) missense unknown
IGL02382:Ep400 APN 5 110,849,594 (GRCm39) missense unknown
IGL02419:Ep400 APN 5 110,845,242 (GRCm39) splice site probably null
IGL02591:Ep400 APN 5 110,881,638 (GRCm39) unclassified probably benign
IGL02981:Ep400 APN 5 110,839,476 (GRCm39) splice site probably benign
IGL02981:Ep400 APN 5 110,903,969 (GRCm39) missense possibly damaging 0.79
IGL03173:Ep400 APN 5 110,856,737 (GRCm39) unclassified probably benign
IGL03244:Ep400 APN 5 110,875,429 (GRCm39) missense unknown
IGL03333:Ep400 APN 5 110,851,432 (GRCm39) missense unknown
santol UTSW 5 110,849,537 (GRCm39) missense unknown
PIT4243001:Ep400 UTSW 5 110,883,446 (GRCm39) missense unknown
PIT4260001:Ep400 UTSW 5 110,841,037 (GRCm39) nonsense probably null
R0017:Ep400 UTSW 5 110,821,395 (GRCm39) missense probably damaging 1.00
R0179:Ep400 UTSW 5 110,816,515 (GRCm39) missense probably damaging 0.99
R0243:Ep400 UTSW 5 110,872,273 (GRCm39) splice site probably benign
R0366:Ep400 UTSW 5 110,849,537 (GRCm39) missense unknown
R0508:Ep400 UTSW 5 110,887,374 (GRCm39) missense probably benign 0.00
R0541:Ep400 UTSW 5 110,852,882 (GRCm39) missense unknown
R0558:Ep400 UTSW 5 110,832,933 (GRCm39) splice site probably benign
R0576:Ep400 UTSW 5 110,858,959 (GRCm39) unclassified probably benign
R0595:Ep400 UTSW 5 110,851,408 (GRCm39) missense unknown
R0671:Ep400 UTSW 5 110,836,062 (GRCm39) missense unknown
R0763:Ep400 UTSW 5 110,813,703 (GRCm39) missense probably damaging 1.00
R1078:Ep400 UTSW 5 110,883,388 (GRCm39) unclassified probably benign
R1300:Ep400 UTSW 5 110,821,426 (GRCm39) missense probably damaging 1.00
R1439:Ep400 UTSW 5 110,833,344 (GRCm39) missense unknown
R1520:Ep400 UTSW 5 110,839,644 (GRCm39) intron probably benign
R1529:Ep400 UTSW 5 110,887,311 (GRCm39) missense probably benign 0.00
R1535:Ep400 UTSW 5 110,856,032 (GRCm39) unclassified probably benign
R1560:Ep400 UTSW 5 110,818,972 (GRCm39) splice site probably null
R1587:Ep400 UTSW 5 110,874,768 (GRCm39) missense probably benign 0.23
R1596:Ep400 UTSW 5 110,856,727 (GRCm39) unclassified probably benign
R1653:Ep400 UTSW 5 110,841,040 (GRCm39) nonsense probably null
R1711:Ep400 UTSW 5 110,841,174 (GRCm39) unclassified probably benign
R1774:Ep400 UTSW 5 110,833,357 (GRCm39) missense unknown
R1836:Ep400 UTSW 5 110,852,920 (GRCm39) missense unknown
R1905:Ep400 UTSW 5 110,818,814 (GRCm39) missense probably damaging 1.00
R1917:Ep400 UTSW 5 110,851,441 (GRCm39) missense unknown
R2064:Ep400 UTSW 5 110,883,270 (GRCm39) unclassified probably benign
R2122:Ep400 UTSW 5 110,856,716 (GRCm39) unclassified probably benign
R2144:Ep400 UTSW 5 110,851,384 (GRCm39) missense unknown
R2215:Ep400 UTSW 5 110,841,421 (GRCm39) unclassified probably benign
R2252:Ep400 UTSW 5 110,866,957 (GRCm39) missense unknown
R2253:Ep400 UTSW 5 110,866,957 (GRCm39) missense unknown
R2483:Ep400 UTSW 5 110,867,102 (GRCm39) missense unknown
R2504:Ep400 UTSW 5 110,816,511 (GRCm39) missense probably damaging 1.00
R2512:Ep400 UTSW 5 110,856,781 (GRCm39) unclassified probably benign
R2842:Ep400 UTSW 5 110,846,681 (GRCm39) nonsense probably null
R2920:Ep400 UTSW 5 110,903,780 (GRCm39) missense probably damaging 1.00
R3082:Ep400 UTSW 5 110,841,096 (GRCm39) unclassified probably benign
R3151:Ep400 UTSW 5 110,851,435 (GRCm39) missense unknown
R3552:Ep400 UTSW 5 110,877,153 (GRCm39) missense unknown
R3623:Ep400 UTSW 5 110,867,102 (GRCm39) missense unknown
R3779:Ep400 UTSW 5 110,839,515 (GRCm39) missense unknown
R3923:Ep400 UTSW 5 110,904,389 (GRCm39) missense possibly damaging 0.55
R4062:Ep400 UTSW 5 110,889,847 (GRCm39) missense probably benign 0.10
R4508:Ep400 UTSW 5 110,851,481 (GRCm39) missense unknown
R4584:Ep400 UTSW 5 110,881,763 (GRCm39) unclassified probably benign
R4585:Ep400 UTSW 5 110,901,725 (GRCm39) missense probably damaging 1.00
R4586:Ep400 UTSW 5 110,901,725 (GRCm39) missense probably damaging 1.00
R4807:Ep400 UTSW 5 110,843,444 (GRCm39) splice site probably null
R4921:Ep400 UTSW 5 110,813,676 (GRCm39) missense probably damaging 1.00
R4976:Ep400 UTSW 5 110,868,622 (GRCm39) missense unknown
R4976:Ep400 UTSW 5 110,846,678 (GRCm39) missense unknown
R5075:Ep400 UTSW 5 110,833,351 (GRCm39) missense unknown
R5122:Ep400 UTSW 5 110,816,036 (GRCm39) missense probably damaging 1.00
R5223:Ep400 UTSW 5 110,816,496 (GRCm39) missense probably damaging 1.00
R5284:Ep400 UTSW 5 110,815,990 (GRCm39) missense probably damaging 1.00
R5388:Ep400 UTSW 5 110,849,594 (GRCm39) missense unknown
R5401:Ep400 UTSW 5 110,831,037 (GRCm39) missense unknown
R5431:Ep400 UTSW 5 110,824,420 (GRCm39) missense unknown
R5461:Ep400 UTSW 5 110,824,550 (GRCm39) nonsense probably null
R5568:Ep400 UTSW 5 110,904,071 (GRCm39) missense probably damaging 1.00
R5650:Ep400 UTSW 5 110,843,818 (GRCm39) critical splice donor site probably null
R5778:Ep400 UTSW 5 110,867,450 (GRCm39) missense unknown
R5806:Ep400 UTSW 5 110,903,420 (GRCm39) nonsense probably null
R5814:Ep400 UTSW 5 110,843,444 (GRCm39) splice site probably null
R5830:Ep400 UTSW 5 110,831,862 (GRCm39) missense unknown
R5882:Ep400 UTSW 5 110,903,453 (GRCm39) missense probably benign 0.00
R5931:Ep400 UTSW 5 110,883,386 (GRCm39) unclassified probably benign
R5945:Ep400 UTSW 5 110,830,732 (GRCm39) missense unknown
R5966:Ep400 UTSW 5 110,824,766 (GRCm39) missense unknown
R5973:Ep400 UTSW 5 110,877,697 (GRCm39) missense unknown
R5980:Ep400 UTSW 5 110,881,595 (GRCm39) unclassified probably benign
R6000:Ep400 UTSW 5 110,831,067 (GRCm39) missense unknown
R6006:Ep400 UTSW 5 110,852,825 (GRCm39) missense unknown
R6053:Ep400 UTSW 5 110,903,661 (GRCm39) missense probably benign 0.22
R6145:Ep400 UTSW 5 110,904,569 (GRCm39) missense possibly damaging 0.95
R6154:Ep400 UTSW 5 110,903,799 (GRCm39) missense probably damaging 0.97
R6169:Ep400 UTSW 5 110,889,863 (GRCm39) missense possibly damaging 0.83
R6228:Ep400 UTSW 5 110,818,808 (GRCm39) missense probably damaging 1.00
R6295:Ep400 UTSW 5 110,901,675 (GRCm39) missense probably benign 0.00
R6486:Ep400 UTSW 5 110,845,084 (GRCm39) unclassified probably benign
R6504:Ep400 UTSW 5 110,856,703 (GRCm39) unclassified probably benign
R6607:Ep400 UTSW 5 110,831,180 (GRCm39) missense unknown
R6657:Ep400 UTSW 5 110,841,411 (GRCm39) unclassified probably benign
R6660:Ep400 UTSW 5 110,867,313 (GRCm39) nonsense probably null
R6741:Ep400 UTSW 5 110,824,761 (GRCm39) missense unknown
R6933:Ep400 UTSW 5 110,813,728 (GRCm39) missense probably damaging 1.00
R6937:Ep400 UTSW 5 110,859,018 (GRCm39) unclassified probably benign
R7069:Ep400 UTSW 5 110,815,990 (GRCm39) missense probably damaging 1.00
R7103:Ep400 UTSW 5 110,881,651 (GRCm39) missense unknown
R7156:Ep400 UTSW 5 110,833,229 (GRCm39) missense unknown
R7272:Ep400 UTSW 5 110,903,511 (GRCm39) nonsense probably null
R7365:Ep400 UTSW 5 110,867,480 (GRCm39) missense unknown
R7581:Ep400 UTSW 5 110,903,891 (GRCm39) missense unknown
R7684:Ep400 UTSW 5 110,845,218 (GRCm39) missense unknown
R7699:Ep400 UTSW 5 110,843,898 (GRCm39) missense unknown
R7700:Ep400 UTSW 5 110,843,898 (GRCm39) missense unknown
R7856:Ep400 UTSW 5 110,814,450 (GRCm39) missense probably damaging 0.99
R7954:Ep400 UTSW 5 110,816,599 (GRCm39) missense possibly damaging 0.46
R8098:Ep400 UTSW 5 110,841,117 (GRCm39) missense unknown
R8108:Ep400 UTSW 5 110,835,749 (GRCm39) missense unknown
R8260:Ep400 UTSW 5 110,903,478 (GRCm39) nonsense probably null
R8293:Ep400 UTSW 5 110,856,758 (GRCm39) missense unknown
R8314:Ep400 UTSW 5 110,903,619 (GRCm39) missense unknown
R8351:Ep400 UTSW 5 110,887,200 (GRCm39) missense probably damaging 1.00
R8424:Ep400 UTSW 5 110,841,144 (GRCm39) missense unknown
R8459:Ep400 UTSW 5 110,856,757 (GRCm39) missense unknown
R8529:Ep400 UTSW 5 110,867,102 (GRCm39) missense unknown
R8688:Ep400 UTSW 5 110,868,685 (GRCm39) missense unknown
R8744:Ep400 UTSW 5 110,889,925 (GRCm39) missense unknown
R8923:Ep400 UTSW 5 110,831,864 (GRCm39) missense unknown
R9005:Ep400 UTSW 5 110,858,959 (GRCm39) missense unknown
R9087:Ep400 UTSW 5 110,815,430 (GRCm39) nonsense probably null
R9146:Ep400 UTSW 5 110,849,635 (GRCm39) nonsense probably null
R9383:Ep400 UTSW 5 110,833,351 (GRCm39) missense unknown
R9479:Ep400 UTSW 5 110,877,730 (GRCm39) missense unknown
R9496:Ep400 UTSW 5 110,855,853 (GRCm39) missense unknown
R9582:Ep400 UTSW 5 110,824,315 (GRCm39) critical splice donor site probably null
R9607:Ep400 UTSW 5 110,831,805 (GRCm39) missense unknown
R9712:Ep400 UTSW 5 110,904,509 (GRCm39) missense unknown
R9746:Ep400 UTSW 5 110,889,872 (GRCm39) missense unknown
X0012:Ep400 UTSW 5 110,821,062 (GRCm39) small deletion probably benign
X0021:Ep400 UTSW 5 110,830,730 (GRCm39) missense unknown
Z1176:Ep400 UTSW 5 110,904,501 (GRCm39) missense unknown
Z1177:Ep400 UTSW 5 110,881,609 (GRCm39) missense unknown
Z1177:Ep400 UTSW 5 110,831,230 (GRCm39) missense unknown
Z1188:Ep400 UTSW 5 110,903,549 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GCCTCCTGAAATACAAAGTGAC -3'
(R):5'- ATGAGCAGAAGTCCTGTGGC -3'

Sequencing Primer
(F):5'- TCCTGAAATACAAAGTGACCACCAC -3'
(R):5'- CCGGGCAGAATGTGAACATC -3'
Posted On 2016-06-15