Incidental Mutation 'R5120:Eogt'
ID392921
Institutional Source Beutler Lab
Gene Symbol Eogt
Ensembl Gene ENSMUSG00000035245
Gene NameEGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase
SynonymsA130022J15Rik
MMRRC Submission 042708-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R5120 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location97110024-97149182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97134315 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 195 (V195A)
Ref Sequence ENSEMBL: ENSMUSP00000061610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054344] [ENSMUST00000113387] [ENSMUST00000136575]
Predicted Effect probably benign
Transcript: ENSMUST00000054344
AA Change: V195A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000061610
Gene: ENSMUSG00000035245
AA Change: V195A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:DUF563 245 472 1.3e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113387
SMART Domains Protein: ENSMUSP00000109014
Gene: ENSMUSG00000035245

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135187
Predicted Effect probably benign
Transcript: ENSMUST00000136575
SMART Domains Protein: ENSMUSP00000117541
Gene: ENSMUSG00000035245

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.6%
Validation Efficiency 100% (97/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that acts in the lumen of the endoplasmic reticulum to catalyze the transfer of N-acetylglucosamine to serine or threonine residues of extracellular-targeted proteins. This enzyme modifies proteins containing eukaryotic growth factor (EGF)-like domains, including the Notch receptor, thereby regulating developmental signalling. Mutations in this gene have been observed in individuals with Adams-Oliver syndrome 4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,210,235 H225R probably benign Het
Abcc9 T A 6: 142,656,618 I690F probably benign Het
Acp4 A T 7: 44,256,971 D52E probably damaging Het
Adam17 T C 12: 21,343,019 probably benign Het
Adamts15 T C 9: 30,921,576 E221G probably damaging Het
Aoc2 A G 11: 101,325,714 T208A probably benign Het
Apoa4 T G 9: 46,242,737 I212S probably damaging Het
Bptf A T 11: 107,073,385 M1598K probably damaging Het
Camsap3 G A 8: 3,600,680 R209Q probably damaging Het
Ccdc171 C A 4: 83,558,526 probably benign Het
Celsr2 G C 3: 108,393,120 P2875A probably benign Het
Cenpb A G 2: 131,179,818 V20A probably benign Het
Cfap61 A T 2: 146,143,160 K975* probably null Het
Col9a2 G T 4: 121,039,772 A20S unknown Het
Crnn A T 3: 93,148,896 I330F probably benign Het
Csf3r C A 4: 126,035,827 P381Q probably benign Het
Csmd3 G A 15: 48,673,495 Q104* probably null Het
Ctnna1 G A 18: 35,182,554 probably null Het
Cwf19l2 C T 9: 3,418,761 Q183* probably null Het
Ddx60 T C 8: 61,945,906 Y220H probably benign Het
Dhh T C 15: 98,898,157 Q39R probably benign Het
Dynlrb2 T A 8: 116,515,698 I89N possibly damaging Het
Dytn T C 1: 63,623,043 E645G probably benign Het
Efcab7 A G 4: 99,897,491 T287A probably damaging Het
Ep400 G T 5: 110,756,358 P125Q probably damaging Het
Fasn A G 11: 120,811,391 V1815A probably benign Het
Gm4788 T C 1: 139,753,103 S226G probably benign Het
Gm5866 T C 5: 52,582,882 noncoding transcript Het
Gm8674 C A 13: 49,901,948 noncoding transcript Het
Gpat4 G T 8: 23,180,202 H270Q possibly damaging Het
Grik5 A G 7: 25,010,640 L890P probably damaging Het
Gsap A G 5: 21,269,936 N500S probably damaging Het
H2-M10.1 T C 17: 36,325,156 D173G probably benign Het
Igfn1 T A 1: 135,973,502 I413F possibly damaging Het
Ighv1-52 G T 12: 115,145,786 H17N probably benign Het
Kcnu1 T A 8: 25,934,488 D270E possibly damaging Het
Kif16b A C 2: 142,848,339 N274K probably damaging Het
Klk1b11 C T 7: 43,999,022 T151I probably benign Het
Krtap13 A G 16: 88,751,570 F10S probably damaging Het
Large1 A T 8: 72,859,341 I379N probably damaging Het
Lhx8 T C 3: 154,311,695 H301R probably damaging Het
Lrriq3 T C 3: 155,129,384 V252A probably benign Het
Lysmd3 T A 13: 81,669,192 I96N probably damaging Het
Mpeg1 C T 19: 12,461,429 Q84* probably null Het
Myoz1 C T 14: 20,650,654 G165D probably benign Het
Myt1 G A 2: 181,797,620 V312I probably benign Het
Ndufb7 T C 8: 83,566,977 probably benign Het
Numa1 C T 7: 101,977,437 T10M probably damaging Het
Olfr1285 T C 2: 111,409,240 noncoding transcript Het
Olfr130 A T 17: 38,067,266 I32F probably damaging Het
Olfr1316 A T 2: 112,130,558 D84E probably damaging Het
Olfr149 T A 9: 39,702,070 H233L probably benign Het
Olfr390 A C 11: 73,786,964 I9L probably benign Het
Osmr A T 15: 6,827,275 S464T probably benign Het
Pak7 G A 2: 136,083,229 H718Y probably damaging Het
Pan2 T A 10: 128,314,995 probably null Het
Pik3r4 T C 9: 105,669,009 S853P probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Polr3gl T A 3: 96,578,479 probably benign Het
Psd2 G A 18: 35,979,810 R186Q possibly damaging Het
Psd4 T C 2: 24,405,438 V868A probably benign Het
Ralgapa2 G T 2: 146,412,084 T852K probably benign Het
Rbm43 T C 2: 51,932,423 probably benign Het
Rps6kl1 C A 12: 85,139,348 G329C probably damaging Het
Scaf11 T C 15: 96,419,542 T714A probably benign Het
Selenoo C A 15: 89,094,305 N310K possibly damaging Het
Sepsecs T C 5: 52,660,661 Q258R probably damaging Het
Sgcz T C 8: 37,526,266 S226G probably benign Het
Slfn5 A G 11: 82,960,928 K627E probably damaging Het
Sos1 A T 17: 80,408,248 F1027I probably damaging Het
Ssh1 C G 5: 113,957,398 V228L possibly damaging Het
Sugp1 C A 8: 70,048,667 P65T probably benign Het
Tas2r106 T A 6: 131,678,816 N24I probably damaging Het
Tex10 T C 4: 48,459,272 E534G possibly damaging Het
Tmem182 C T 1: 40,854,901 T192I possibly damaging Het
Traf7 T A 17: 24,518,744 K51* probably null Het
Trap1 C A 16: 4,044,088 R604L probably damaging Het
Trim6 T A 7: 104,228,240 L179Q probably damaging Het
Ubfd1 T C 7: 122,071,750 S264P probably damaging Het
Upk3bl T C 5: 136,064,191 probably benign Het
Wdfy3 T A 5: 101,868,106 Q2601L possibly damaging Het
Wdr89 A G 12: 75,632,638 Y281H probably damaging Het
Zfp286 A T 11: 62,780,725 M174K probably benign Het
Zmym1 T C 4: 127,051,437 probably null Het
Other mutations in Eogt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Eogt APN 6 97120000 missense probably damaging 0.97
IGL01292:Eogt APN 6 97144027 missense possibly damaging 0.88
IGL02332:Eogt APN 6 97125605 missense probably damaging 1.00
IGL02439:Eogt APN 6 97143973 missense possibly damaging 0.83
R0019:Eogt UTSW 6 97134273 unclassified probably benign
R0112:Eogt UTSW 6 97135284 splice site probably benign
R0325:Eogt UTSW 6 97113955 missense probably damaging 0.99
R0497:Eogt UTSW 6 97135233 missense probably benign 0.00
R0730:Eogt UTSW 6 97116009 nonsense probably null
R1730:Eogt UTSW 6 97113864 missense probably damaging 1.00
R1783:Eogt UTSW 6 97113864 missense probably damaging 1.00
R2074:Eogt UTSW 6 97131376 missense probably benign 0.02
R2279:Eogt UTSW 6 97134301 missense probably benign 0.28
R2679:Eogt UTSW 6 97120800 missense probably benign 0.01
R2993:Eogt UTSW 6 97118954 splice site probably null
R3176:Eogt UTSW 6 97131394 missense probably benign 0.21
R3276:Eogt UTSW 6 97131394 missense probably benign 0.21
R3876:Eogt UTSW 6 97120190 missense probably damaging 0.99
R3940:Eogt UTSW 6 97113914 missense probably damaging 1.00
R4613:Eogt UTSW 6 97134304 missense probably benign 0.00
R4704:Eogt UTSW 6 97113852 missense probably damaging 0.99
R4849:Eogt UTSW 6 97116055 missense probably damaging 0.99
R4867:Eogt UTSW 6 97120147 intron probably benign
R4905:Eogt UTSW 6 97142831 missense probably benign 0.01
R5143:Eogt UTSW 6 97125584 missense probably damaging 1.00
R5594:Eogt UTSW 6 97116035 missense probably benign 0.01
R6351:Eogt UTSW 6 97120194 missense probably damaging 1.00
R6418:Eogt UTSW 6 97145392 missense possibly damaging 0.77
R6498:Eogt UTSW 6 97135213 missense probably damaging 1.00
R6950:Eogt UTSW 6 97134382 missense possibly damaging 0.77
R7114:Eogt UTSW 6 97116004 missense probably damaging 1.00
R7185:Eogt UTSW 6 97120178 missense probably damaging 1.00
R7221:Eogt UTSW 6 97112724 missense probably damaging 1.00
R7232:Eogt UTSW 6 97119983 missense probably damaging 0.98
R7467:Eogt UTSW 6 97142833 missense probably benign 0.01
R7526:Eogt UTSW 6 97113952 missense probably damaging 1.00
R7672:Eogt UTSW 6 97113909 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGCACACATCAGGAAA -3'
(R):5'- CTGTTGTAGGGCGCCTGTC -3'

Sequencing Primer
(F):5'- CAATTCCTAGCAACTACGTGGTGG -3'
(R):5'- ATTACCCTGGGTTACATGAGACC -3'
Posted On2016-06-15